ID: 1122955745

View in Genome Browser
Species Human (GRCh38)
Location 14:105070111-105070133
Sequence CAGCCTCCCCGAGACAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122955744_1122955745 10 Left 1122955744 14:105070078-105070100 CCAGGGAAGGGGTTTTTAGGGAA No data
Right 1122955745 14:105070111-105070133 CAGCCTCCCCGAGACAGAAGAGG No data
1122955740_1122955745 21 Left 1122955740 14:105070067-105070089 CCAGGTCTCAGCCAGGGAAGGGG No data
Right 1122955745 14:105070111-105070133 CAGCCTCCCCGAGACAGAAGAGG No data
1122955736_1122955745 23 Left 1122955736 14:105070065-105070087 CCCCAGGTCTCAGCCAGGGAAGG No data
Right 1122955745 14:105070111-105070133 CAGCCTCCCCGAGACAGAAGAGG No data
1122955738_1122955745 22 Left 1122955738 14:105070066-105070088 CCCAGGTCTCAGCCAGGGAAGGG No data
Right 1122955745 14:105070111-105070133 CAGCCTCCCCGAGACAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122955745 Original CRISPR CAGCCTCCCCGAGACAGAAG AGG Intergenic