ID: 1122957090

View in Genome Browser
Species Human (GRCh38)
Location 14:105075937-105075959
Sequence CGACGCCCCCACGGGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122957083_1122957090 20 Left 1122957083 14:105075894-105075916 CCAGGGGAAAGCTCAGAGCTGTC No data
Right 1122957090 14:105075937-105075959 CGACGCCCCCACGGGAGGGCTGG No data
1122957084_1122957090 -2 Left 1122957084 14:105075916-105075938 CCTGTTTTAGAATCATTGTTCCG No data
Right 1122957090 14:105075937-105075959 CGACGCCCCCACGGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122957090 Original CRISPR CGACGCCCCCACGGGAGGGC TGG Intergenic
No off target data available for this crispr