ID: 1122959249

View in Genome Browser
Species Human (GRCh38)
Location 14:105087132-105087154
Sequence GTCCGTGGACGGCGTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122959249_1122959253 -10 Left 1122959249 14:105087132-105087154 CCCTCAGCACGCCGTCCACGGAC No data
Right 1122959253 14:105087145-105087167 GTCCACGGACACGGCTCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122959249 Original CRISPR GTCCGTGGACGGCGTGCTGA GGG (reversed) Intergenic