ID: 1122959578

View in Genome Browser
Species Human (GRCh38)
Location 14:105088283-105088305
Sequence GAGGGGCGGCTCCCAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122959578_1122959592 22 Left 1122959578 14:105088283-105088305 CCAGGCCCTGGGAGCCGCCCCTC No data
Right 1122959592 14:105088328-105088350 CTTTGCCAAACCGCCAGCCCGGG No data
1122959578_1122959596 29 Left 1122959578 14:105088283-105088305 CCAGGCCCTGGGAGCCGCCCCTC No data
Right 1122959596 14:105088335-105088357 AAACCGCCAGCCCGGGCGGAGGG No data
1122959578_1122959593 25 Left 1122959578 14:105088283-105088305 CCAGGCCCTGGGAGCCGCCCCTC No data
Right 1122959593 14:105088331-105088353 TGCCAAACCGCCAGCCCGGGCGG No data
1122959578_1122959595 28 Left 1122959578 14:105088283-105088305 CCAGGCCCTGGGAGCCGCCCCTC No data
Right 1122959595 14:105088334-105088356 CAAACCGCCAGCCCGGGCGGAGG No data
1122959578_1122959591 21 Left 1122959578 14:105088283-105088305 CCAGGCCCTGGGAGCCGCCCCTC No data
Right 1122959591 14:105088327-105088349 TCTTTGCCAAACCGCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122959578 Original CRISPR GAGGGGCGGCTCCCAGGGCC TGG (reversed) Intergenic