ID: 1122961807

View in Genome Browser
Species Human (GRCh38)
Location 14:105097334-105097356
Sequence GAGATGCTCAGCCCCTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122961801_1122961807 15 Left 1122961801 14:105097296-105097318 CCACAGCAAGGAGAGCCCTCACC No data
Right 1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG No data
1122961803_1122961807 -1 Left 1122961803 14:105097312-105097334 CCTCACCAAGAGCCTGCAGAATG No data
Right 1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG No data
1122961802_1122961807 0 Left 1122961802 14:105097311-105097333 CCCTCACCAAGAGCCTGCAGAAT No data
Right 1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG No data
1122961800_1122961807 20 Left 1122961800 14:105097291-105097313 CCAAACCACAGCAAGGAGAGCCC No data
Right 1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG No data
1122961804_1122961807 -6 Left 1122961804 14:105097317-105097339 CCAAGAGCCTGCAGAATGAGATG No data
Right 1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG No data
1122961798_1122961807 22 Left 1122961798 14:105097289-105097311 CCCCAAACCACAGCAAGGAGAGC No data
Right 1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG No data
1122961799_1122961807 21 Left 1122961799 14:105097290-105097312 CCCAAACCACAGCAAGGAGAGCC No data
Right 1122961807 14:105097334-105097356 GAGATGCTCAGCCCCTGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122961807 Original CRISPR GAGATGCTCAGCCCCTGTCT GGG Intergenic
No off target data available for this crispr