ID: 1122964773

View in Genome Browser
Species Human (GRCh38)
Location 14:105117600-105117622
Sequence TGCAGATAACAGACCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122964773_1122964777 4 Left 1122964773 14:105117600-105117622 CCCACCAAGGTCTGTTATCTGCA No data
Right 1122964777 14:105117627-105117649 CTTCTGGTGTCAAATACTGTAGG No data
1122964773_1122964779 23 Left 1122964773 14:105117600-105117622 CCCACCAAGGTCTGTTATCTGCA No data
Right 1122964779 14:105117646-105117668 TAGGAGTCAGGATTCAGCTGTGG No data
1122964773_1122964778 11 Left 1122964773 14:105117600-105117622 CCCACCAAGGTCTGTTATCTGCA No data
Right 1122964778 14:105117634-105117656 TGTCAAATACTGTAGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122964773 Original CRISPR TGCAGATAACAGACCTTGGT GGG (reversed) Intergenic
No off target data available for this crispr