ID: 1122967443

View in Genome Browser
Species Human (GRCh38)
Location 14:105137957-105137979
Sequence CCCTGGGTCTGGGGGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122967432_1122967443 6 Left 1122967432 14:105137928-105137950 CCTGCTGACCTCAGGGGCTCCTT No data
Right 1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG No data
1122967425_1122967443 27 Left 1122967425 14:105137907-105137929 CCATCCGAGACCTCACAGGTCCC No data
Right 1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG No data
1122967427_1122967443 17 Left 1122967427 14:105137917-105137939 CCTCACAGGTCCCTGCTGACCTC No data
Right 1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG No data
1122967434_1122967443 -2 Left 1122967434 14:105137936-105137958 CCTCAGGGGCTCCTTGGAAGACC No data
Right 1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG No data
1122967431_1122967443 7 Left 1122967431 14:105137927-105137949 CCCTGCTGACCTCAGGGGCTCCT No data
Right 1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG No data
1122967426_1122967443 23 Left 1122967426 14:105137911-105137933 CCGAGACCTCACAGGTCCCTGCT No data
Right 1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122967443 Original CRISPR CCCTGGGTCTGGGGGTCTGA TGG Intergenic
No off target data available for this crispr