ID: 1122967888

View in Genome Browser
Species Human (GRCh38)
Location 14:105139700-105139722
Sequence CGCCCACCATGGACACACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122967874_1122967888 29 Left 1122967874 14:105139648-105139670 CCAGTGGGCTCAGGACACTGGAT No data
Right 1122967888 14:105139700-105139722 CGCCCACCATGGACACACGCAGG No data
1122967873_1122967888 30 Left 1122967873 14:105139647-105139669 CCCAGTGGGCTCAGGACACTGGA No data
Right 1122967888 14:105139700-105139722 CGCCCACCATGGACACACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122967888 Original CRISPR CGCCCACCATGGACACACGC AGG Intergenic
No off target data available for this crispr