ID: 1122968057

View in Genome Browser
Species Human (GRCh38)
Location 14:105140687-105140709
Sequence TTGGGGCCACGGCAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122968040_1122968057 19 Left 1122968040 14:105140645-105140667 CCTCAGTGGCTGCCCTTCTGCCT No data
Right 1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG No data
1122968042_1122968057 7 Left 1122968042 14:105140657-105140679 CCCTTCTGCCTGAACTGCCTGGC No data
Right 1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG No data
1122968043_1122968057 6 Left 1122968043 14:105140658-105140680 CCTTCTGCCTGAACTGCCTGGCC No data
Right 1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG No data
1122968044_1122968057 -1 Left 1122968044 14:105140665-105140687 CCTGAACTGCCTGGCCAACCCCT No data
Right 1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG No data
1122968048_1122968057 -10 Left 1122968048 14:105140674-105140696 CCTGGCCAACCCCTTGGGGCCAC No data
Right 1122968057 14:105140687-105140709 TTGGGGCCACGGCAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122968057 Original CRISPR TTGGGGCCACGGCAGGAGGT GGG Intergenic
No off target data available for this crispr