ID: 1122968686

View in Genome Browser
Species Human (GRCh38)
Location 14:105143764-105143786
Sequence GGTGGTGAAGTCGCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122968686_1122968698 7 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968698 14:105143794-105143816 GAGTGGGGAGTAGCGGGGGGAGG 0: 1
1: 0
2: 8
3: 117
4: 994
1122968686_1122968693 0 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968693 14:105143787-105143809 AGGCAGTGAGTGGGGAGTAGCGG 0: 1
1: 0
2: 3
3: 82
4: 703
1122968686_1122968690 -8 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968690 14:105143779-105143801 TCACCACCAGGCAGTGAGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 225
1122968686_1122968694 1 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968694 14:105143788-105143810 GGCAGTGAGTGGGGAGTAGCGGG 0: 1
1: 0
2: 8
3: 53
4: 539
1122968686_1122968702 17 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968702 14:105143804-105143826 TAGCGGGGGGAGGAGTGGAGGGG 0: 1
1: 0
2: 2
3: 80
4: 1227
1122968686_1122968688 -10 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968688 14:105143777-105143799 CTTCACCACCAGGCAGTGAGTGG 0: 1
1: 0
2: 3
3: 17
4: 245
1122968686_1122968703 20 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968703 14:105143807-105143829 CGGGGGGAGGAGTGGAGGGGTGG 0: 1
1: 1
2: 35
3: 527
4: 5473
1122968686_1122968704 23 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968704 14:105143810-105143832 GGGGAGGAGTGGAGGGGTGGAGG 0: 1
1: 6
2: 71
3: 527
4: 3906
1122968686_1122968689 -9 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968689 14:105143778-105143800 TTCACCACCAGGCAGTGAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 153
1122968686_1122968696 3 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968696 14:105143790-105143812 CAGTGAGTGGGGAGTAGCGGGGG 0: 1
1: 0
2: 1
3: 24
4: 302
1122968686_1122968697 4 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968697 14:105143791-105143813 AGTGAGTGGGGAGTAGCGGGGGG 0: 1
1: 0
2: 9
3: 61
4: 436
1122968686_1122968701 16 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968701 14:105143803-105143825 GTAGCGGGGGGAGGAGTGGAGGG 0: 1
1: 0
2: 10
3: 67
4: 962
1122968686_1122968699 12 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968699 14:105143799-105143821 GGGAGTAGCGGGGGGAGGAGTGG 0: 1
1: 1
2: 15
3: 228
4: 2506
1122968686_1122968700 15 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968700 14:105143802-105143824 AGTAGCGGGGGGAGGAGTGGAGG 0: 1
1: 4
2: 6
3: 73
4: 953
1122968686_1122968695 2 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968695 14:105143789-105143811 GCAGTGAGTGGGGAGTAGCGGGG 0: 1
1: 0
2: 1
3: 32
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122968686 Original CRISPR GGTGGTGAAGTCGCCACTGC AGG (reversed) Intronic
902117108 1:14130281-14130303 GGGAGTGAAGTCCCCACTGATGG - Intergenic
902517489 1:16997140-16997162 AGTGCTGAAGACGGCACTGCCGG - Exonic
903342126 1:22661088-22661110 GCAGGTGAACTTGCCACTGCGGG - Exonic
906879351 1:49573907-49573929 GGTGGGGATGTTGCCACTACTGG - Intronic
908072984 1:60484065-60484087 GGTTGTCATGTTGCCACTGCAGG - Intergenic
914325681 1:146613269-146613291 AGTGGTGATATCCCCACTGCTGG + Intergenic
917137732 1:171803725-171803747 GGTGGTGAACGCGCACCTGCAGG + Intronic
1063180394 10:3592954-3592976 TGTTGTGAAGACGCCAATGCTGG - Intergenic
1067802372 10:49367975-49367997 GGTGGGGAAGTCCCAGCTGCTGG - Intronic
1070627810 10:78063606-78063628 GATGGTGAAGTCTCCCCTGTGGG + Intergenic
1073095036 10:100974125-100974147 GGAGATGAAGATGCCACTGCGGG - Intronic
1073179350 10:101574531-101574553 GGTGCTGGAGTCCCTACTGCAGG - Intronic
1073784525 10:106873902-106873924 GGCTCTGAAGTCGCCAATGCAGG + Intronic
1077536572 11:3127539-3127561 GGTGGGGGAGCAGCCACTGCCGG - Intronic
1077794069 11:5472417-5472439 GCTGGTGAAGTGTCCACTGAAGG + Intronic
1087750882 11:102005650-102005672 GGTGGTGAAGCCTCCCCTGTGGG - Intergenic
1088264795 11:107978959-107978981 GGAGGGGATGTTGCCACTGCTGG - Intergenic
1091490691 12:930015-930037 AGTGCAGAAGTCCCCACTGCTGG + Intronic
1091923518 12:4324566-4324588 AGTGGTGAAGACGCACCTGCGGG - Intronic
1092132843 12:6124580-6124602 GGCTGTGGAGTCCCCACTGCTGG + Exonic
1093964207 12:25308373-25308395 GGAGGGGATGTTGCCACTGCTGG - Intergenic
1095489360 12:42717025-42717047 AGTGCTGCAGTGGCCACTGCTGG + Intergenic
1096603155 12:52744876-52744898 GTTGCTCCAGTCGCCACTGCTGG + Intergenic
1098901207 12:76113673-76113695 GGTGGTGATGTTTTCACTGCTGG - Intergenic
1099062025 12:77923704-77923726 GTTGGTCAAGTTTCCACTGCTGG - Intronic
1100241525 12:92714281-92714303 GGTGGGGATGTTGCCACTACTGG + Intergenic
1103364507 12:120371360-120371382 CGTGGGTAGGTCGCCACTGCCGG - Intergenic
1103421728 12:120790552-120790574 GGTGGAGAAGTCGTCATTTCAGG - Intronic
1104395658 12:128430138-128430160 GGTGGTTAAATGCCCACTGCAGG - Intronic
1104964890 12:132504481-132504503 GGGGGTGCTGGCGCCACTGCAGG + Intronic
1105026554 12:132853037-132853059 TCTGGTGACATCGCCACTGCTGG + Intronic
1105214204 13:18274801-18274823 GGTGGCCAAGTCTGCACTGCTGG - Intergenic
1115805919 14:37051624-37051646 GGTATTGAAGTAGCCACTGTTGG - Intronic
1116158732 14:41239260-41239282 GGAGGGGATGTCGCCACTACTGG + Intergenic
1118881123 14:69826608-69826630 GGTGGGGATGTTGCCACTACTGG + Intergenic
1119417281 14:74480749-74480771 GGTGGTGGAGTGGCAACTTCAGG - Exonic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1121308954 14:92924421-92924443 GCTGGGGAAGTCCCCACAGCAGG - Intronic
1122228353 14:100292540-100292562 CGTGGTCAAGTCGCGGCTGCAGG - Exonic
1122968686 14:105143764-105143786 GGTGGTGAAGTCGCCACTGCAGG - Intronic
1122968754 14:105143965-105143987 GCTGGTGAGGTCCCCACCGCAGG - Intronic
1122968789 14:105144060-105144082 GGTGGCGAGGTCCCCACCGCAGG - Intronic
1123029749 14:105446106-105446128 GGTGGTGGAGTCTCCTGTGCCGG + Intronic
1202852596 14_GL000225v1_random:30740-30762 GGTTGTGAGGTCCCCTCTGCCGG - Intergenic
1127352062 15:58162948-58162970 GGTGGTGAATTCTTCAGTGCTGG + Intronic
1132112207 15:99109859-99109881 GGGGGTAGAGTGGCCACTGCAGG + Intronic
1132549319 16:547845-547867 GGTGGTGAAGTCGGGGCTGGAGG - Exonic
1136613818 16:31383227-31383249 GGTGGAAAAGTAGCCACTGGAGG - Intergenic
1136724757 16:32348791-32348813 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1136843083 16:33554831-33554853 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1140007883 16:71097671-71097693 AGTGGTGATATCCCCACTGCTGG - Intronic
1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG + Intronic
1203001673 16_KI270728v1_random:168964-168986 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203133277 16_KI270728v1_random:1705370-1705392 TGTGGAGCAGTCGCCGCTGCCGG + Intergenic
1203153248 16_KI270728v1_random:1855129-1855151 TGTGGAGCAGTCGCCGCTGCCGG - Intergenic
1142950492 17:3474963-3474985 GGTGTTGACATCCCCACTGCAGG - Intronic
1146223517 17:31047167-31047189 GGTGGTGAAGATGCCATTGTAGG + Intergenic
1146341468 17:32022801-32022823 GGTGGTGAAGATGCCATTGTAGG - Exonic
1147721369 17:42541591-42541613 GTTGCTGAAGTAGGCACTGCAGG + Intronic
1151227725 17:72659056-72659078 GGTGGCCAAGTTGCCACTGCAGG - Intronic
1152627997 17:81397001-81397023 GGTGGCGGCGTCGCCGCTGCGGG + Intronic
1158218044 18:55121124-55121146 GTAGGTGATGTGGCCACTGCAGG - Intergenic
1160903337 19:1440151-1440173 AGTGGTGAAGACGCACCTGCGGG + Exonic
1161295739 19:3519364-3519386 GCTTGTGAAGCCGCCAGTGCTGG + Intronic
1162057752 19:8074916-8074938 GGTAGTGAGTTCCCCACTGCTGG - Intronic
1165276040 19:34752473-34752495 GGTGGGGAATTGGCCACTGCTGG - Intergenic
929048191 2:37811232-37811254 GGTGGTGAAGTCTGGACTTCTGG + Intergenic
934300115 2:91771949-91771971 GGTGGCCAAGTCTGCACTGCTGG + Intergenic
935147762 2:100407771-100407793 GGTGGTGAGCTCCCCACTGCAGG - Intronic
940887265 2:159000641-159000663 GGTGGTGGAGTCCACACTGTGGG + Intronic
941986654 2:171517464-171517486 AGTGGTGAAGACGCACCTGCGGG - Intergenic
943750694 2:191506695-191506717 GGTGGTGCAGTCTTCCCTGCTGG - Intergenic
944743642 2:202635242-202635264 GGTGGTGCGGTGGCCACGGCCGG + Exonic
946938722 2:224748925-224748947 GATGGTGAAATGGTCACTGCAGG + Intergenic
948818394 2:240525656-240525678 GGTGGTGCAGTGGCCACCGGGGG + Intronic
1171409106 20:24934353-24934375 GGGGGTGAAATGGCCAATGCTGG - Intergenic
1174257817 20:49271418-49271440 GGTGGGGAGTCCGCCACTGCTGG + Exonic
1174354596 20:49989555-49989577 GGTGGTGACCTCACCACTGGGGG + Intergenic
1178100012 21:29257899-29257921 AGTGGTGAAGTCAGGACTGCAGG + Intronic
1181269951 22:21652959-21652981 GGTGGTGGGGTCCCCCCTGCTGG + Intronic
1181974889 22:26721920-26721942 GGTGGTGAGCTCCCCATTGCTGG - Intergenic
1183463266 22:37965958-37965980 GGTGGTAGAGTCCCCACTGTGGG + Intronic
1184253876 22:43276230-43276252 GCTGGAGAAGTGGCCACTGCTGG + Intronic
950279367 3:11693332-11693354 GGTAATGAAGTAGCCCCTGCAGG - Intronic
954093001 3:48300486-48300508 GGTGGTGAAGACGGAACTGAAGG - Intronic
955429866 3:58831707-58831729 GGTGGTTGTGTCGTCACTGCTGG + Exonic
956417861 3:69052100-69052122 GGTGCTGCCGCCGCCACTGCCGG - Exonic
961400184 3:126635092-126635114 TGTGGTGACGTGGTCACTGCTGG - Intronic
969631779 4:8343213-8343235 GGAGTTGAAGGCACCACTGCGGG + Intergenic
980966298 4:139524542-139524564 GGAGGTGATGGGGCCACTGCTGG + Intronic
982700164 4:158651938-158651960 GGTGGAAATGTGGCCACTGCAGG + Exonic
986751916 5:10794964-10794986 GGTGGGGATGTGGCCTCTGCTGG + Intergenic
988233610 5:28509677-28509699 GGAGGTGATGTTGCCACTTCTGG + Intergenic
988268750 5:28986562-28986584 GGTGGTGAAGCCACCTCTGCTGG + Intergenic
994291732 5:98034575-98034597 GGAGGGGATGTTGCCACTGCTGG + Intergenic
1000712761 5:164601196-164601218 AGTGGTGAAGACGCACCTGCGGG - Intergenic
1002255128 5:177952912-177952934 GGAGGTGAGGTCGCAGCTGCTGG - Intergenic
1002482953 5:179515496-179515518 GGAGGTGAGGTCGCAGCTGCTGG + Intergenic
1019662432 7:2232448-2232470 GGTGGAGAAGTCGGGGCTGCAGG - Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1027832785 7:83201506-83201528 GGTGGAGAAGTAGCCAATGGAGG - Intergenic
1034982353 7:155487281-155487303 GATGGTGCAGCCCCCACTGCTGG + Intronic
1039640829 8:39219067-39219089 GGTGGTGAAGTCCCCATTCCAGG - Intronic
1044588669 8:93892470-93892492 GGTGGTGTCCTCCCCACTGCAGG + Intronic
1047614857 8:126556010-126556032 GTTTGTGGAGTCGCCACTGCGGG - Exonic
1048286456 8:133145641-133145663 GGTGGTGACGTCGGCACTTCTGG - Intergenic
1048448235 8:134509053-134509075 GATGGTGAAGTCTCCACTGAGGG + Intronic
1049336488 8:142089405-142089427 GCTGCTGCAGTCTCCACTGCTGG - Intergenic
1055733758 9:79306193-79306215 GGTGATGCAGTGGCCACTGAAGG + Intergenic
1062450302 9:136612612-136612634 GATGGTGGAATCGCCACTGTCGG + Intergenic
1191609893 X:63101449-63101471 GGTGGAAAAGCCGCCACTGAGGG + Intergenic
1192736651 X:73855685-73855707 GGTGGCTAAGTCGACAGTGCCGG - Intergenic
1197404750 X:126036586-126036608 GGAGGTGATGTTGCCACTACTGG - Intergenic
1199673308 X:150164400-150164422 AGTGGAGAACTAGCCACTGCAGG - Intergenic