ID: 1122968686

View in Genome Browser
Species Human (GRCh38)
Location 14:105143764-105143786
Sequence GGTGGTGAAGTCGCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122968686_1122968700 15 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968700 14:105143802-105143824 AGTAGCGGGGGGAGGAGTGGAGG 0: 1
1: 4
2: 6
3: 73
4: 953
1122968686_1122968699 12 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968699 14:105143799-105143821 GGGAGTAGCGGGGGGAGGAGTGG 0: 1
1: 1
2: 15
3: 228
4: 2506
1122968686_1122968698 7 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968698 14:105143794-105143816 GAGTGGGGAGTAGCGGGGGGAGG 0: 1
1: 0
2: 8
3: 117
4: 994
1122968686_1122968704 23 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968704 14:105143810-105143832 GGGGAGGAGTGGAGGGGTGGAGG 0: 1
1: 6
2: 71
3: 527
4: 3906
1122968686_1122968702 17 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968702 14:105143804-105143826 TAGCGGGGGGAGGAGTGGAGGGG 0: 1
1: 0
2: 2
3: 80
4: 1227
1122968686_1122968703 20 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968703 14:105143807-105143829 CGGGGGGAGGAGTGGAGGGGTGG 0: 1
1: 1
2: 35
3: 527
4: 5473
1122968686_1122968693 0 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968693 14:105143787-105143809 AGGCAGTGAGTGGGGAGTAGCGG 0: 1
1: 0
2: 3
3: 82
4: 703
1122968686_1122968695 2 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968695 14:105143789-105143811 GCAGTGAGTGGGGAGTAGCGGGG 0: 1
1: 0
2: 1
3: 32
4: 254
1122968686_1122968689 -9 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968689 14:105143778-105143800 TTCACCACCAGGCAGTGAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 153
1122968686_1122968688 -10 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968688 14:105143777-105143799 CTTCACCACCAGGCAGTGAGTGG 0: 1
1: 0
2: 3
3: 17
4: 245
1122968686_1122968697 4 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968697 14:105143791-105143813 AGTGAGTGGGGAGTAGCGGGGGG 0: 1
1: 0
2: 9
3: 61
4: 436
1122968686_1122968701 16 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968701 14:105143803-105143825 GTAGCGGGGGGAGGAGTGGAGGG 0: 1
1: 0
2: 10
3: 67
4: 962
1122968686_1122968690 -8 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968690 14:105143779-105143801 TCACCACCAGGCAGTGAGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 225
1122968686_1122968694 1 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968694 14:105143788-105143810 GGCAGTGAGTGGGGAGTAGCGGG 0: 1
1: 0
2: 8
3: 53
4: 539
1122968686_1122968696 3 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968696 14:105143790-105143812 CAGTGAGTGGGGAGTAGCGGGGG 0: 1
1: 0
2: 1
3: 24
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122968686 Original CRISPR GGTGGTGAAGTCGCCACTGC AGG (reversed) Intronic