ID: 1122968690

View in Genome Browser
Species Human (GRCh38)
Location 14:105143779-105143801
Sequence TCACCACCAGGCAGTGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122968684_1122968690 0 Left 1122968684 14:105143756-105143778 CCCGGGGTCCTGCAGTGGCGACT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1122968690 14:105143779-105143801 TCACCACCAGGCAGTGAGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 225
1122968685_1122968690 -1 Left 1122968685 14:105143757-105143779 CCGGGGTCCTGCAGTGGCGACTT 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1122968690 14:105143779-105143801 TCACCACCAGGCAGTGAGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 225
1122968686_1122968690 -8 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968690 14:105143779-105143801 TCACCACCAGGCAGTGAGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122968690 Original CRISPR TCACCACCAGGCAGTGAGTG GGG Intronic