ID: 1122968697

View in Genome Browser
Species Human (GRCh38)
Location 14:105143791-105143813
Sequence AGTGAGTGGGGAGTAGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 9, 3: 61, 4: 436}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122968686_1122968697 4 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968697 14:105143791-105143813 AGTGAGTGGGGAGTAGCGGGGGG 0: 1
1: 0
2: 9
3: 61
4: 436
1122968685_1122968697 11 Left 1122968685 14:105143757-105143779 CCGGGGTCCTGCAGTGGCGACTT 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1122968697 14:105143791-105143813 AGTGAGTGGGGAGTAGCGGGGGG 0: 1
1: 0
2: 9
3: 61
4: 436
1122968684_1122968697 12 Left 1122968684 14:105143756-105143778 CCCGGGGTCCTGCAGTGGCGACT 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1122968697 14:105143791-105143813 AGTGAGTGGGGAGTAGCGGGGGG 0: 1
1: 0
2: 9
3: 61
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122968697 Original CRISPR AGTGAGTGGGGAGTAGCGGG GGG Intronic