ID: 1122968704

View in Genome Browser
Species Human (GRCh38)
Location 14:105143810-105143832
Sequence GGGGAGGAGTGGAGGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4511
Summary {0: 1, 1: 6, 2: 71, 3: 527, 4: 3906}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122968691_1122968704 5 Left 1122968691 14:105143782-105143804 CCACCAGGCAGTGAGTGGGGAGT 0: 2
1: 0
2: 2
3: 22
4: 182
Right 1122968704 14:105143810-105143832 GGGGAGGAGTGGAGGGGTGGAGG 0: 1
1: 6
2: 71
3: 527
4: 3906
1122968686_1122968704 23 Left 1122968686 14:105143764-105143786 CCTGCAGTGGCGACTTCACCACC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1122968704 14:105143810-105143832 GGGGAGGAGTGGAGGGGTGGAGG 0: 1
1: 6
2: 71
3: 527
4: 3906
1122968692_1122968704 2 Left 1122968692 14:105143785-105143807 CCAGGCAGTGAGTGGGGAGTAGC 0: 1
1: 0
2: 1
3: 17
4: 216
Right 1122968704 14:105143810-105143832 GGGGAGGAGTGGAGGGGTGGAGG 0: 1
1: 6
2: 71
3: 527
4: 3906
1122968685_1122968704 30 Left 1122968685 14:105143757-105143779 CCGGGGTCCTGCAGTGGCGACTT 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1122968704 14:105143810-105143832 GGGGAGGAGTGGAGGGGTGGAGG 0: 1
1: 6
2: 71
3: 527
4: 3906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122968704 Original CRISPR GGGGAGGAGTGGAGGGGTGG AGG Intronic