ID: 1122970473

View in Genome Browser
Species Human (GRCh38)
Location 14:105150149-105150171
Sequence CAGTACCAACAGATGGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122970473 Original CRISPR CAGTACCAACAGATGGTCAG AGG Intronic
903013940 1:20349902-20349924 AAGTCCCCACAGCTGGTCAGTGG + Intronic
903125866 1:21247213-21247235 CACCACCGACAGATGGTAAGAGG - Exonic
903699713 1:25237969-25237991 CAGTACCTACATAAGATCAGAGG + Intergenic
906781408 1:48576083-48576105 CAGTACCAATCCATGGCCAGGGG - Intronic
908251112 1:62266726-62266748 GAGTACCAAGAGCTGGTCTGTGG + Exonic
908785895 1:67734218-67734240 TAGTACAAGCAGATGGTGAGAGG + Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911184334 1:94888137-94888159 CAAGACCAACAGCTAGTCAGTGG + Intronic
912570969 1:110620616-110620638 CCTAACCAACAGATGGTCTGAGG + Intronic
917916884 1:179710926-179710948 CAGAACCAAATAATGGTCAGAGG - Intergenic
918825644 1:189320278-189320300 CAGTACCAACAAAAGGTTATAGG + Intergenic
920849973 1:209622170-209622192 CACTCCCAAGAGATGGACAGAGG + Intronic
920910877 1:210215138-210215160 CAGTTGCAACAGATGTGCAGGGG - Intergenic
922727901 1:227933125-227933147 CAGTAACAACAGATCTTCAGCGG - Intronic
924787471 1:247211517-247211539 CAGTACTCACACATGGCCAGTGG + Intergenic
1063039673 10:2324261-2324283 CACTAACAACAGATCTTCAGTGG - Intergenic
1064211814 10:13366200-13366222 CACCACCAACAAATGGTCAGGGG - Intergenic
1064539979 10:16395535-16395557 CAGAAACAACCAATGGTCAGCGG + Intergenic
1065540344 10:26759589-26759611 AAGTACCAAAAGATGGTGTGAGG + Intronic
1069722346 10:70557728-70557750 CAGTCCCCAAAGATGGCCAGTGG - Intronic
1069814138 10:71182862-71182884 CAGTTTCAACAGATGAACAGGGG + Intergenic
1074343789 10:112660616-112660638 CAGTACCTACATGTGGTTAGCGG - Intronic
1074708516 10:116157677-116157699 CAACACCATCACATGGTCAGTGG + Intronic
1075252067 10:120888429-120888451 CAGTTCTAATAGATGCTCAGAGG - Intronic
1075826473 10:125360856-125360878 TACTACCAACAGATGGAAAGAGG - Intergenic
1086817749 11:91394242-91394264 CCGTATGAACAGAGGGTCAGAGG - Intergenic
1087081744 11:94177606-94177628 CAGGACCACCAGTTGGTCAGAGG - Intronic
1088057143 11:105597774-105597796 CACTATCAACTGAGGGTCAGAGG + Intergenic
1088363139 11:109011989-109012011 CAGCACTAACAGATAGTCAGAGG + Intergenic
1088830329 11:113531373-113531395 CGGTACCAAGAAATGGTCATGGG - Intergenic
1089169945 11:116504949-116504971 CATTCCCAGCAGATGGTCAGAGG + Intergenic
1091329502 11:134720021-134720043 CAGTACCAACAGATAACCAGTGG - Intergenic
1091747961 12:3004508-3004530 CAGTAGCCACAGATGGGCACTGG + Intronic
1102218837 12:111180644-111180666 CAGTCCCACCAGATCCTCAGAGG - Intronic
1102391094 12:112549301-112549323 CAGTACCAACCGGTGGCCTGGGG + Intergenic
1103038255 12:117673664-117673686 CATTACCAAGGCATGGTCAGGGG + Intronic
1103871921 12:124098446-124098468 AAGCACCAACATATGGTAAGTGG - Intronic
1106640376 13:31578466-31578488 CAGTAGTAAAAGATGGACAGTGG + Intergenic
1108878131 13:55073530-55073552 CAATAAAAACAGATTGTCAGAGG - Intergenic
1109708319 13:66129418-66129440 CAGTATAAACAGCTGGTCATTGG + Intergenic
1110641650 13:77831242-77831264 CAGTATCAATATAAGGTCAGTGG - Intergenic
1112215408 13:97425824-97425846 CAGAACCAGAAGATGGTCAGTGG - Intergenic
1112853311 13:103733838-103733860 CAGTGCCAAGAGATATTCAGAGG - Intergenic
1113045844 13:106153634-106153656 CAGTGCCAAGAGATGGGCTGTGG + Intergenic
1121166839 14:91810132-91810154 CAGGAGCAAGAGATGGGCAGTGG + Intronic
1121955122 14:98206486-98206508 CAGTGGCAACAGAGGGCCAGAGG - Intergenic
1122970473 14:105150149-105150171 CAGTACCAACAGATGGTCAGAGG + Intronic
1125536886 15:40446191-40446213 CAGTACCAGGAGGTGGGCAGGGG - Intronic
1127566896 15:60198380-60198402 CAGTCCCAACTGATTATCAGAGG - Intergenic
1130650865 15:85761380-85761402 GAGCACCATCAGATGGGCAGGGG + Intronic
1133286387 16:4692780-4692802 CAGTACAAACACAAGGTAAGTGG + Intergenic
1133692645 16:8231316-8231338 CAATAAGAACACATGGTCAGAGG - Intergenic
1136470391 16:30475666-30475688 AAGTTCCCACAGATGGTCAAAGG + Intronic
1138405301 16:56788175-56788197 CAGGACCAACAGAAGTCCAGTGG - Intronic
1139315032 16:66060648-66060670 GAGCACCACCAAATGGTCAGGGG + Intergenic
1139316338 16:66072769-66072791 CAGAAGCAACAGAAGGTAAGAGG + Intergenic
1139922590 16:70469311-70469333 CAGTACCCACCCATGGTAAGGGG - Exonic
1144949457 17:18986075-18986097 CAGGACCCACAGCAGGTCAGCGG + Intronic
1145274050 17:21419631-21419653 CAGCACCAGCAGAGGCTCAGGGG - Exonic
1145311913 17:21705530-21705552 CAGCACCAGCAGAGGCTCAGGGG - Intergenic
1146483763 17:33227100-33227122 CAGTAGCCACACATGGCCAGTGG + Intronic
1147993646 17:44349997-44350019 TAATACCAACCCATGGTCAGTGG + Intronic
1148682190 17:49480813-49480835 CAGAGCCAAGAGATGGTCAGTGG - Intergenic
1151783931 17:76265955-76265977 CACCACCACCAGATGGTAAGCGG + Exonic
1157108577 18:44798414-44798436 CAGAAAGAAAAGATGGTCAGAGG - Intronic
1157251587 18:46100415-46100437 AAGAACAAACAGATGGTTAGAGG + Intronic
1157818406 18:50747984-50748006 CAGAACCAAGAGAGGTTCAGAGG - Intergenic
1158047288 18:53171327-53171349 CAGAACCAGCAGGTGATCAGAGG + Intronic
1160619072 18:80157918-80157940 CAGCACCACCTGCTGGTCAGTGG - Exonic
1160723602 19:608168-608190 CAGTACCAGGAGAAGGTCTGAGG + Exonic
1163084219 19:14967869-14967891 CAGAACCAGCCCATGGTCAGTGG - Intronic
1165995998 19:39844610-39844632 CAGAACCAACAGATTGTATGTGG - Intronic
1168092043 19:54092139-54092161 CAGTATGAAAAGATGTTCAGTGG + Intergenic
927119547 2:19943736-19943758 CAGTACCTTCAGAGGGTCACTGG + Intronic
927276080 2:21263547-21263569 CACTTGCAACAGAAGGTCAGTGG + Intergenic
928399832 2:30969744-30969766 ACGTACCCACAGCTGGTCAGTGG - Intronic
929595936 2:43175907-43175929 CACTGGCAGCAGATGGTCAGAGG + Intergenic
931836452 2:66103940-66103962 CAGTGCCCAGAGATGGGCAGTGG + Intergenic
931884215 2:66598333-66598355 CAGCACCAACATTTGGTCAAGGG - Intergenic
932081511 2:68719862-68719884 AGGTACCAAGAGAAGGTCAGAGG - Intronic
934575527 2:95398291-95398313 CAGAACCAGCCCATGGTCAGTGG + Intergenic
935711437 2:105902421-105902443 CAGTCCTAACAGATCTTCAGAGG - Intergenic
935815101 2:106839977-106839999 CAGTTCCAACAGAAGGGTAGGGG + Intronic
936100146 2:109570369-109570391 CAGAACCCACAGATGATGAGGGG - Intronic
942916908 2:181320981-181321003 CAGTTGCAAGTGATGGTCAGTGG + Intergenic
945907504 2:215611830-215611852 CAGTAGGAACAAATGCTCAGAGG - Intergenic
946623915 2:221590852-221590874 CAGTAACCACATATGGTAAGTGG + Intergenic
1170777739 20:19392251-19392273 CTGTACCCACAGGTGATCAGAGG - Intronic
1172132823 20:32667100-32667122 CAGCAGCCACAGATGGTCAGTGG + Intergenic
1172354162 20:34268172-34268194 CAGTAGCCACAGATGACCAGTGG + Intronic
1173454841 20:43193496-43193518 CAGTAGCCACAGGTGGCCAGTGG + Intergenic
1174550799 20:51360162-51360184 CAGGACCAGCAGGTGGTCACAGG + Intergenic
1179537015 21:42059347-42059369 CTGTCCCCACAAATGGTCAGGGG - Intergenic
1180671862 22:17559850-17559872 CAGTAACAACAGAGTATCAGTGG - Intergenic
1181550013 22:23632484-23632506 CAGTCCCCACAGAGGGGCAGGGG - Intergenic
1181573548 22:23780565-23780587 CAGTACCTACAGATGGGTGGGGG - Exonic
1183842539 22:40511743-40511765 CAGTAGTAACAGATGTTCATGGG + Intronic
953485316 3:43289112-43289134 CAGTACGAACAGATGAACTGTGG + Intronic
956260053 3:67329476-67329498 CAGCACCAACAGGAGATCAGAGG + Intergenic
956671045 3:71690810-71690832 CAGTGCTAACAGATGGTCATTGG - Intronic
961146411 3:124597635-124597657 CAGTAGCCACAAATGGCCAGTGG - Intronic
964827055 3:160840111-160840133 CAGTAGGAACAAATGGTAAGTGG + Intronic
965099866 3:164282201-164282223 TAATACCAACAGAAGGTTAGAGG + Intergenic
965310300 3:167118605-167118627 CAGTTCCAACACAGGGGCAGAGG - Intergenic
966704960 3:182902624-182902646 CAATATCAAAAGATGGGCAGAGG + Intronic
967111892 3:186301237-186301259 GAGGACCAACAGATGGACATGGG - Intronic
967955484 3:194874530-194874552 CAGTAGCAACGGCAGGTCAGGGG - Intergenic
972745960 4:41933145-41933167 CAGAACCAGCCTATGGTCAGTGG + Intergenic
976396271 4:84559113-84559135 CAGTAGCCACATATGGTTAGTGG + Intergenic
977212948 4:94242467-94242489 GTGTACCAAGAGATGGCCAGAGG - Intronic
981022807 4:140046926-140046948 TAGTACCAACAGCAGCTCAGAGG - Intronic
982122383 4:152155719-152155741 CAGTAACCACATGTGGTCAGCGG + Intergenic
985525283 5:398453-398475 CAGTGACCACAGATGGTCAGAGG - Intronic
985780610 5:1868975-1868997 CAGGACCTGCAGATGGGCAGAGG + Intergenic
986970730 5:13332929-13332951 CAGTAGCCACATATGGCCAGTGG - Intergenic
990325642 5:54672729-54672751 CATGACCAAAAGATGGTCACAGG - Intergenic
990499952 5:56386133-56386155 CAGTACAATCAGTTGGTGAGTGG + Intergenic
991971697 5:72147684-72147706 CAGTACAGACAGAAGGTGAGTGG + Intronic
992556033 5:77904565-77904587 CCATACCAACAGATGTTCAGTGG + Intergenic
994948161 5:106423243-106423265 CAGCACCAGCAGAGGGTGAGAGG - Intergenic
996096729 5:119407119-119407141 CAATGCCAACATATGGGCAGAGG - Intergenic
997885900 5:137629874-137629896 CAATGCCACCAGATGGTTAGGGG - Intronic
998812641 5:145981789-145981811 CAATAACCACAGATGGGCAGTGG + Intronic
999666910 5:153922150-153922172 CAGGACCAACGGATGGGTAGAGG + Intergenic
1005479074 6:26238263-26238285 CAGTAGCCACATATGGTTAGTGG - Intergenic
1005806017 6:29475205-29475227 CAGTAGCAACAGGAGGTCAAAGG + Intergenic
1005814213 6:29537908-29537930 CAGCAGCAACAGAAGGTCAAAGG + Intergenic
1005869987 6:29967708-29967730 CTGTACAAACAGCTGATCAGGGG + Intergenic
1007782026 6:44259905-44259927 AAGTTCCCACAGTTGGTCAGTGG + Intronic
1011133795 6:84077913-84077935 CAGTAACCACACATGGCCAGTGG - Intronic
1011518608 6:88179917-88179939 AAGTACCAGCAGGTGATCAGAGG - Intergenic
1020736155 7:11950953-11950975 CAGTCCTAACAGATATTCAGAGG - Intergenic
1021787382 7:24165173-24165195 CAGTAGCAACAGAGGGTGGGAGG + Intergenic
1021901029 7:25285785-25285807 CACTACCCAGAGTTGGTCAGGGG - Intergenic
1022336049 7:29423234-29423256 CAGCACCCACTGATTGTCAGGGG - Intronic
1023970178 7:44985219-44985241 CAGTAGCCACAGGTGGCCAGTGG - Intergenic
1024143320 7:46484146-46484168 CAGTAGCAACATATGGCCATTGG - Intergenic
1024260637 7:47571571-47571593 CAGTACCTCCAGAGGGTCAAGGG + Intronic
1027184552 7:75963121-75963143 GAGTGCCAACAGATGGGAAGTGG + Intronic
1028756801 7:94445072-94445094 GATTGCCAACAGATGGTGAGGGG - Intergenic
1030168474 7:106578044-106578066 CAATACCTACATATGGTTAGTGG + Intergenic
1030852929 7:114513266-114513288 CAGAACCAACAAATGGTCAGGGG + Intronic
1030903368 7:115151424-115151446 CAGATCCAAGAGATGGTAAGTGG - Intergenic
1031895573 7:127345064-127345086 CAGAACAAACAAATGGTTAGTGG + Intergenic
1034881679 7:154767582-154767604 CAGTGCCAATAGAAGCTCAGAGG - Intronic
1035783032 8:2243925-2243947 CAGAACCAACAGGTGAGCAGGGG - Intergenic
1035809095 8:2475661-2475683 CAGAACCAACAGGTGAGCAGGGG + Intergenic
1038088050 8:24221886-24221908 CAGTAGCCACAACTGGTCAGGGG - Intergenic
1038959397 8:32502225-32502247 CAGGAGCAACAGAGGGTAAGGGG + Intronic
1044565919 8:93661154-93661176 CAGGAACAAAAGAGGGTCAGGGG - Intergenic
1046804549 8:118465254-118465276 AAGTACCTTCAGATGGTGAGTGG + Intronic
1047772556 8:128042043-128042065 CAGTACCAAGAGATGCTAAATGG - Intergenic
1048483349 8:134823088-134823110 CACTACCAACACCTGGTCATGGG + Intergenic
1049393170 8:142382418-142382440 CAGTGCCGGCAGCTGGTCAGTGG - Intronic
1049583198 8:143421906-143421928 CTGTACCAAGAGCTGGGCAGAGG + Intronic
1051756377 9:20405343-20405365 CACCACTACCAGATGGTCAGAGG + Intronic
1053225360 9:36350502-36350524 GAGAATCAACAGATGGTCTGTGG - Intronic
1057298430 9:93862522-93862544 CAGTGCCAACAGAAAGTGAGAGG + Intergenic
1057799732 9:98183200-98183222 CAGTAGCAACAGAGGGTTGGAGG - Intronic
1060178691 9:121516659-121516681 CAGGACCAAGAGATGGTGGGGGG - Intergenic
1185725937 X:2421957-2421979 GAGCACCAACAGATGTCCAGAGG + Intronic
1189856994 X:45233521-45233543 CAGGAACAAAAGGTGGTCAGCGG - Intergenic
1190096802 X:47487879-47487901 CAGTACCCACATATGGCTAGTGG + Intergenic
1192298637 X:69877354-69877376 CAGTACGAAGAGATGGTAACAGG - Intronic
1195073645 X:101305330-101305352 CCGTAGCAACACATGGTCAGTGG - Intergenic
1201962386 Y:19695820-19695842 CAGTTCCAACAGTTGTTTAGTGG - Intergenic