ID: 1122970802

View in Genome Browser
Species Human (GRCh38)
Location 14:105151428-105151450
Sequence CAGTGTGAGCCGTGGGAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122970802 Original CRISPR CAGTGTGAGCCGTGGGAATA AGG Intronic
900549436 1:3246750-3246772 CAGTCTGAGCCCTGGGGTTAGGG - Intronic
905215591 1:36405168-36405190 CAGTGTAAGACATGGGAAAATGG - Intergenic
905484736 1:38287236-38287258 CAGTGCGAGGCGTGGGCAAAAGG + Intergenic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG + Intronic
922820227 1:228479487-228479509 CAGTGTGAGCCCTGGGAGCCTGG - Intergenic
924164814 1:241270515-241270537 TTGTGTCAGCCATGGGAATATGG - Intronic
1062939033 10:1408013-1408035 CAGTGTGAGCCCTTGGAAGGTGG - Intronic
1064712782 10:18143313-18143335 CAGTTTGGGCCGAGGTAATAAGG + Intronic
1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG + Intergenic
1065600830 10:27366873-27366895 CAGTGTGGGCCCTGGGAAATAGG + Intergenic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1068556042 10:58460129-58460151 CAGTGAGTGCCGTGGGAAATGGG - Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1073113970 10:101080540-101080562 AAGAGTCAGTCGTGGGAATAAGG + Intergenic
1074661526 10:115663982-115664004 AAGTGGGAGCTGTGGGAAAATGG - Intronic
1080770950 11:35340875-35340897 CAGTGTGCCCCCTGGGATTATGG + Intronic
1082794907 11:57371689-57371711 CAGGGTCAGCCTTGGGAATTGGG + Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1095302669 12:40604057-40604079 TAGTGTGTACCATGGGAATATGG - Intergenic
1096991993 12:55812128-55812150 CAGAGTGAGCAATGGTAATAAGG - Intronic
1102157657 12:110743470-110743492 CATTGTGAGTGGTGGGTATATGG + Intergenic
1104729074 12:131095064-131095086 CTGAGTGAGCCCTGGGAACAGGG + Intronic
1105432009 13:20345196-20345218 CAGTGTGACCCCTGGGATGAGGG + Intergenic
1110365628 13:74681860-74681882 CAATGTGAGCCCGAGGAATATGG - Intergenic
1112486980 13:99828814-99828836 CACTGTGAGCCTTGCAAATATGG + Intronic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1121398657 14:93652080-93652102 CAGTCTGAGCCATTGCAATAAGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1126676264 15:51161494-51161516 CAGTGTGAGTTGTGGGACTGAGG - Intergenic
1129751459 15:78067717-78067739 CAGTGTGAGAAGTGGGGATTTGG - Intronic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1133667163 16:7979752-7979774 CAGTGGCAGCCCTGGGAATCCGG + Intergenic
1134365179 16:13570627-13570649 CAGTGTGAACAGTGTGAACAAGG + Intergenic
1136294321 16:29293052-29293074 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1139257799 16:65559632-65559654 CGATGTGAGCCCAGGGAATAAGG - Intergenic
1142047567 16:87935472-87935494 CAGTGTGTCCCGTGCGAACACGG + Intronic
1142100227 16:88267099-88267121 CAGTGTGAGCCGCAGGGAGAAGG - Intergenic
1142338651 16:89506979-89507001 CAGTGTCAGCCCTGGGTGTAGGG + Intronic
1144425027 17:15133582-15133604 CACTGTGAGGCGGGAGAATAGGG - Intergenic
1144762873 17:17717262-17717284 AAGTTTGAGCCCTGGGAACAAGG + Intronic
1144878581 17:18418229-18418251 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1144885171 17:18453011-18453033 CAGTGTTAGCTGCTGGAATAAGG - Intergenic
1145147047 17:20491366-20491388 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1145153653 17:20526158-20526180 CAGTGTTAGCTGCTGGAATAAGG - Intergenic
1145177115 17:20710455-20710477 CAGTGTTAGCTGCTGGAATAAGG + Intergenic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1149106613 17:52975063-52975085 TAGTGTGAGCAGTGGGGAAAAGG + Intergenic
1149461938 17:56835288-56835310 CAGAATGCGCCGTGGGAATCAGG + Intronic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1150840347 17:68600903-68600925 CCGAGTGAGCCGAGGGAATGGGG + Exonic
1151606067 17:75136869-75136891 CAGTGGGACCTCTGGGAATAGGG - Intronic
1151816738 17:76474840-76474862 CAGTGTGGGCCCTGGGCATGGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156690352 18:39700137-39700159 CAATGTGAGCCTTGGGAAGCAGG - Intergenic
1156903028 18:42323334-42323356 CAGTGTGAGAGGCAGGAATAAGG + Intergenic
1161289402 19:3485007-3485029 CAGAGTGAGCCGGGGGAGTGGGG + Intergenic
1162069604 19:8145906-8145928 CAGTGTGAGCTGTATGAATGGGG - Exonic
1162446400 19:10725536-10725558 CAGAGGGATCTGTGGGAATATGG + Intronic
1164996028 19:32720660-32720682 GAGTGGGGGCGGTGGGAATAAGG - Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
929022195 2:37564666-37564688 CAGTGTGAGCCTCGGGGATCTGG - Intergenic
931157777 2:59654811-59654833 TTGTGTGAGCCTTGGGAACAAGG + Intergenic
934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG + Intergenic
934641741 2:96031001-96031023 CAGGGTGAGGGGTGGGAATGGGG - Intronic
939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG + Intergenic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
941864131 2:170316110-170316132 CACTGTGAGATATGGGAATATGG - Intronic
943050756 2:182910455-182910477 CAGTTGGAGCCTTGGGAACAAGG + Intronic
1170993555 20:21328872-21328894 AAGAGGGAGCCTTGGGAATAGGG + Intronic
1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG + Intergenic
1172038743 20:32029044-32029066 CAGTGGGAGCCATGGAAAGAAGG - Exonic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1174354250 20:49987826-49987848 CCGAGTGAGCCGTGGGACAACGG - Intronic
1182230198 22:28831969-28831991 CACTGTGAGCCGTCGTAATCTGG + Intergenic
1183030920 22:35103944-35103966 CTGTGTGACCCCTGGGAATAGGG + Intergenic
950865763 3:16187978-16188000 CAGTGTCAGATGTGGGAACAAGG + Intronic
953824956 3:46243609-46243631 AAGTGAGAGTGGTGGGAATAAGG + Intronic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
956838132 3:73112555-73112577 CAGTGTTGGCCGTTGGAATCAGG - Intergenic
961332726 3:126152548-126152570 CAGAGTGAGGCGTGGCAGTATGG - Intronic
962235249 3:133701510-133701532 CTGTGTTAGACGTGGGCATATGG + Intergenic
964952135 3:162308458-162308480 CAGTGTGAGGCCTGGGTTTATGG + Intergenic
967253269 3:187564637-187564659 CAGTTTGAGACGTGGAAATGTGG + Intergenic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
972043118 4:34629142-34629164 CAATGTCACCTGTGGGAATATGG - Intergenic
974390182 4:61257198-61257220 CAGTGATAGACTTGGGAATATGG - Intronic
975260606 4:72293221-72293243 CAGTGTGAGCTGTGAAAACAAGG + Intronic
975723968 4:77274380-77274402 CATTGTGAGCCATGGGTATACGG + Intronic
975893856 4:79062432-79062454 CAATGTGAGGTGTGGGAATGGGG - Intergenic
976072357 4:81256383-81256405 CAGTGTGAGTCGGGGGCACATGG - Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977303774 4:95298366-95298388 CAGTGTGTGCAGTTGGCATAGGG - Intronic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
985268041 4:188168123-188168145 CAATGTGAGCAGTGTGAATTTGG + Intergenic
994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG + Intergenic
1000304554 5:159983568-159983590 CCGTCTTAGCCGTGGGAATGTGG + Intergenic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1003331235 6:5130290-5130312 ACGTGTGAGCCCTGGGAATCTGG + Intronic
1004338742 6:14788353-14788375 CAGTGTGATCCGTGGCCAAATGG + Intergenic
1004970743 6:20907623-20907645 CACTGTGAGCCATGGGACTAAGG + Intronic
1008290090 6:49704972-49704994 CAGTGTAAGCTGTGGTAGTATGG + Intronic
1008675495 6:53813646-53813668 CACTGTGAGCTGTAGGAATCAGG + Intronic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011093477 6:83633382-83633404 CAGTGTCAGCTGTGGTAGTATGG + Intronic
1011643730 6:89437992-89438014 CAGTGTGAGCCTGGGCAACAAGG - Intronic
1013658590 6:112271266-112271288 CAGGGTGGTCCGTGAGAATAAGG - Intergenic
1018364673 6:163107490-163107512 CAGTGTGCGCCGTGTGACTCAGG - Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1044021741 8:87113202-87113224 CAGTGTGAGCCATGGGCAGTAGG + Intronic
1047324021 8:123819299-123819321 CAGGGAGAGCCGTGGGACCAGGG + Intergenic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1196999807 X:121426615-121426637 CACTGTGAGAAGTGAGAATATGG - Intergenic
1198934800 X:141894984-141895006 GAGTGGGAGTGGTGGGAATATGG + Intronic
1200302772 X:154995201-154995223 CAACGTGAGCCTTGGGAAAAAGG - Intronic
1202129671 Y:21598274-21598296 CAGTCTGAGGTGTGAGAATACGG - Intergenic