ID: 1122971387

View in Genome Browser
Species Human (GRCh38)
Location 14:105153645-105153667
Sequence CGAGGCTGTCAGCAACAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122971380_1122971387 11 Left 1122971380 14:105153611-105153633 CCGGTGGGGGGGCGTCCTGCACT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 1122971387 14:105153645-105153667 CGAGGCTGTCAGCAACAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 136
1122971382_1122971387 -4 Left 1122971382 14:105153626-105153648 CCTGCACTGGAACCTGAGCCGAG 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1122971387 14:105153645-105153667 CGAGGCTGTCAGCAACAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 136
1122971379_1122971387 20 Left 1122971379 14:105153602-105153624 CCGCAGCATCCGGTGGGGGGGCG 0: 1
1: 0
2: 1
3: 10
4: 105
Right 1122971387 14:105153645-105153667 CGAGGCTGTCAGCAACAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 136
1122971373_1122971387 26 Left 1122971373 14:105153596-105153618 CCATCTCCGCAGCATCCGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1122971387 14:105153645-105153667 CGAGGCTGTCAGCAACAGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122971387 Original CRISPR CGAGGCTGTCAGCAACAGCT GGG Intronic