ID: 1122972592

View in Genome Browser
Species Human (GRCh38)
Location 14:105158463-105158485
Sequence CCAGGTGGCCCGGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122972592_1122972601 -3 Left 1122972592 14:105158463-105158485 CCCTCTGCCCCCGGGCCACCTGG 0: 1
1: 0
2: 0
3: 40
4: 380
Right 1122972601 14:105158483-105158505 TGGCCCTTGTACCCCAGCCATGG 0: 1
1: 0
2: 1
3: 25
4: 672
1122972592_1122972604 4 Left 1122972592 14:105158463-105158485 CCCTCTGCCCCCGGGCCACCTGG 0: 1
1: 0
2: 0
3: 40
4: 380
Right 1122972604 14:105158490-105158512 TGTACCCCAGCCATGGCGACAGG 0: 1
1: 0
2: 5
3: 189
4: 2842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122972592 Original CRISPR CCAGGTGGCCCGGGGGCAGA GGG (reversed) Intronic
900127243 1:1074015-1074037 CCTGGTGGCCGGGGGTCAGCGGG + Exonic
900337669 1:2172621-2172643 CCAGGGAGCCCCGGGGCACAGGG + Intronic
900370765 1:2331165-2331187 CCAGGTGGACATGGGGCACATGG + Intronic
900405892 1:2492858-2492880 CCCTGAGGCCCGGGGGCAGCAGG + Intronic
900977269 1:6025572-6025594 ACAGGTGGCCCTGGGGAGGACGG - Intronic
901122635 1:6907810-6907832 CCAGGTGGGGCAGGAGCAGAAGG - Intronic
901125361 1:6925113-6925135 GCAGGGGGCCCAAGGGCAGAAGG + Intronic
901197797 1:7449944-7449966 CCAGGTGGCTTGGGGGTAGGAGG + Intronic
902377363 1:16036206-16036228 CCAGGGGGTCCGGGGGGAGGGGG - Intergenic
902621210 1:17652046-17652068 CCAGGTGGTCCTGGGGCAGGGGG + Intronic
902768250 1:18630970-18630992 CTAGGAGACCCGGGGACAGACGG - Intergenic
903221855 1:21873686-21873708 GCAGGGGGCCAGGGGGCTGAAGG + Intronic
903295933 1:22343053-22343075 CCAGGTGTCCCGAGGGCTGCTGG - Intergenic
903474966 1:23613351-23613373 CCAGGTGGGGCGGGGGCTAACGG - Intronic
903768550 1:25749889-25749911 CCAGGTCTCACGGGGGCAGCAGG + Intronic
904401520 1:30259814-30259836 CCAGGTCGCCCTGGGGAAGCCGG + Intergenic
904756217 1:32770207-32770229 GTAGGTGGCCTGGGGGGAGATGG - Exonic
904775078 1:32901412-32901434 CCGGGCGGCCCGGGGGGTGACGG - Intronic
904983450 1:34525648-34525670 CCAGGTGACCCAGGGGAGGAGGG + Intergenic
905204636 1:36336290-36336312 CCAGGAGGCCCAGGAGCTGAAGG - Intergenic
905648363 1:39639949-39639971 CCAGGCGACCCAGGGACAGACGG - Intergenic
905873244 1:41416728-41416750 CCAGGGGGGCGGGGGGCAGAGGG - Intergenic
906724011 1:48030504-48030526 AGAGGTGGGCAGGGGGCAGAGGG - Intergenic
907388313 1:54139987-54140009 CCTGGTAGCCCGGGGGCAGGCGG + Exonic
911415433 1:97566056-97566078 CCAGGTGGAACGGGGGTGGAAGG - Intronic
912414387 1:109498228-109498250 CCAGGTGGTGCGGGGGCTGGTGG + Intronic
915558533 1:156673558-156673580 CCTGCAGGCCTGGGGGCAGAGGG - Intronic
915603842 1:156938744-156938766 ACAGGTGGCCCTTGGGCAGATGG + Intronic
917625836 1:176845240-176845262 CCAGGTGGCCCAGGGCTAGCTGG + Exonic
919924661 1:202186199-202186221 CAAGGGGGCAAGGGGGCAGAGGG - Intergenic
920517833 1:206599682-206599704 CCAGGTGCCCTGGGGCCAGCTGG + Intronic
922175079 1:223190394-223190416 CCAGGTGGGTGGCGGGCAGAAGG - Intergenic
922777752 1:228224541-228224563 CGAGGTGGCCCAGGCCCAGACGG + Exonic
922779849 1:228243265-228243287 CGAGGTGGCCCAGGCCCAGACGG + Exonic
922783838 1:228273354-228273376 TGAGGTGGCCCAGGGCCAGATGG + Exonic
923541785 1:234893474-234893496 CCAGGTGCCCTGGGGACTGACGG + Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
924732475 1:246724497-246724519 GGAGGTGGCCCGGGAGCAGGTGG + Exonic
924787336 1:247210647-247210669 CGAGGTGGGCAGGGGGCTGATGG - Intergenic
1062886509 10:1020705-1020727 CCAGGTTGGCAGCGGGCAGACGG - Intronic
1063219732 10:3956029-3956051 GCAGGTGGCCAGTTGGCAGATGG + Intergenic
1063411679 10:5841037-5841059 GCAGGTGACCGGGGGGCAGGAGG + Intronic
1064213540 10:13380966-13380988 CCAGGTGTGGTGGGGGCAGAAGG + Intergenic
1065119791 10:22517223-22517245 CCAGGAGGCGGGGGGGCAGGGGG - Intergenic
1067945151 10:50684491-50684513 CCAGGTACCCCAGGGGCAGGAGG + Intergenic
1069751282 10:70746837-70746859 CCCGGTGGCAAGTGGGCAGAAGG + Intronic
1069898615 10:71694519-71694541 CCAGGAGGGCAGGTGGCAGAAGG + Intronic
1069987498 10:72294373-72294395 CCTGGTGTCCTGGGGACAGAGGG - Intergenic
1070866657 10:79711363-79711385 CCAGGTACCCCAGGGGCAGGAGG + Exonic
1070880446 10:79849484-79849506 CCAGGTACCCCAGGGGCAGGAGG + Exonic
1071471069 10:85984384-85984406 CCAGGTGGCCAGGTGGTAGATGG - Intronic
1071633568 10:87233586-87233608 CCAGGTACCCCAGGGGCAGGAGG + Exonic
1071647015 10:87365802-87365824 CCAGGTACCCCAGGGGCAGGAGG + Exonic
1072227910 10:93387253-93387275 CAAGGAGGGCCGCGGGCAGAGGG + Intronic
1072633733 10:97164357-97164379 GCTGGAGGCCTGGGGGCAGAGGG + Intronic
1072731546 10:97850132-97850154 TCAGGTGGGCCGGGGGCGGGCGG - Intergenic
1073066829 10:100765734-100765756 CCAGGTAGCACAGGGGCAGAGGG - Intronic
1073290074 10:102409139-102409161 CCGGGCGGCCCGGGGGCCGAGGG - Intronic
1073377067 10:103044768-103044790 GAATGTGGCCCTGGGGCAGATGG + Intronic
1074326704 10:112457576-112457598 CCAGGTGGGCCTGGTGGAGATGG + Intronic
1074721813 10:116271402-116271424 CCAGGATGCCCCGGGGCGGAGGG - Intronic
1074846943 10:117406818-117406840 CCCGATGGCTCTGGGGCAGAGGG + Intergenic
1075403015 10:122174198-122174220 ACAGGTGGCCTAGGGGCTGAGGG + Intronic
1075520830 10:123142722-123142744 CCAGGTGCCCCGCGGGCGCAAGG - Intergenic
1076187198 10:128459149-128459171 CCAGGGAACCCGGTGGCAGATGG + Intergenic
1076258104 10:129044846-129044868 CCAGGAGGCCAGTGGGCAGTCGG + Intergenic
1076574328 10:131453796-131453818 CCAGGGGGTCCCGGGGCACAGGG - Intergenic
1076691036 10:132223990-132224012 CCAGGAGGCACTGGGGCAAAGGG + Intronic
1077071459 11:675974-675996 CCAGGTGCCCCGGGGGATGTCGG - Intronic
1077254239 11:1573307-1573329 GCTGGGGGCTCGGGGGCAGAAGG - Intergenic
1077374060 11:2197419-2197441 CCAGGTGGCCGGGCTGCAGGAGG + Intergenic
1078316210 11:10294747-10294769 CCGGGTGGGCCGGGGGCGGTCGG + Intergenic
1080791434 11:35525636-35525658 CCAGGGAGGCCGGGGGCAGGCGG + Intronic
1082833983 11:57638990-57639012 CGAGGGGGACCGGGGGCCGAAGG + Intergenic
1083410450 11:62488905-62488927 CCAGGAAGACAGGGGGCAGAGGG + Intronic
1083437585 11:62653206-62653228 CCAGGTGGCCCTGGGGCCCCGGG + Exonic
1083571791 11:63765145-63765167 CCCGGAGGGCCGGGGGCAGCAGG - Exonic
1083728801 11:64642489-64642511 CCGGTTGGCCCGGGGGCGGGGGG - Intronic
1083804426 11:65065756-65065778 CCAGGAGGCCCTGGGCCAGAGGG + Intergenic
1084461298 11:69298070-69298092 CCAGGTGGCAGGGAGGCAGCCGG - Intronic
1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG + Intronic
1084965386 11:72741771-72741793 CCACGTGCCCTGGGGGCCGAGGG + Intronic
1085517003 11:77117414-77117436 CCAGGCAGACTGGGGGCAGATGG + Intronic
1089190549 11:116650265-116650287 CCAGGTGGGCAGTGGGCAGGTGG - Intergenic
1089572602 11:119420360-119420382 GCAGGTCTCCCGAGGGCAGAAGG - Exonic
1089684562 11:120138458-120138480 CCAGAGGCCCCTGGGGCAGAAGG + Intronic
1090078475 11:123594395-123594417 GCAGTTGGCCCAGTGGCAGAAGG + Intronic
1090872727 11:130762511-130762533 CCAGGTGGTCCCAGGGCAAAGGG - Intergenic
1091020575 11:132096019-132096041 TCATGGGGCCTGGGGGCAGAGGG - Intronic
1091866436 12:3841338-3841360 CCAGGTAGGCCTGGTGCAGAGGG - Intronic
1093464936 12:19439753-19439775 CCGGGCTGCCGGGGGGCAGAGGG - Exonic
1094375502 12:29784067-29784089 CAAGGCGGGCCGGGGGCAGAGGG - Intronic
1096231618 12:49900061-49900083 CCAGGTGGCCAGGCCACAGAGGG + Intronic
1096454205 12:51771717-51771739 ACAAGTGGCCCAGGGGCAGGCGG - Intronic
1096675062 12:53221749-53221771 CCGGGCGGCCCGGCGGCTGAGGG - Intronic
1096690922 12:53321324-53321346 CCAGGTGGCCAGGGCGAGGAGGG - Exonic
1096747846 12:53739936-53739958 CCAGGAGGGGCGGGGGCCGAGGG + Intergenic
1096776122 12:53965463-53965485 CCAGGTGTTCCTGGGGGAGAGGG - Intergenic
1097280356 12:57841698-57841720 ACAGGTGGCCGGGGGTCAGAGGG - Intronic
1097330086 12:58323573-58323595 TCAGGGGGCTCGGGGGAAGAAGG - Intergenic
1099365122 12:81758860-81758882 CCGGGTGGCCCGGGCGCGGAGGG - Intronic
1100985608 12:100199621-100199643 CCAGGTGGCCGAGGGGCAGCGGG + Intronic
1102006942 12:109595178-109595200 CCAGGTATCCCGGGGGTAGGTGG + Exonic
1102467017 12:113135824-113135846 CGAGGGGGCCCGGGGTCAGGTGG - Intronic
1103527565 12:121578534-121578556 CCAGGGGGCCGGCGGACAGAGGG - Intronic
1103739277 12:123080556-123080578 CCAGCTGGCCCTGGGGCCCAAGG + Intronic
1104598792 12:130138637-130138659 GCAAGCGGCCCGCGGGCAGAGGG + Intergenic
1104728748 12:131093759-131093781 CCAGCTGGCTGGGAGGCAGAGGG - Intronic
1104933877 12:132354363-132354385 CCAGGTTGCAGAGGGGCAGACGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1106329226 13:28723867-28723889 CCAAGTGGCCGGCGGCCAGACGG + Intergenic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1108004231 13:45931424-45931446 CTAGGTGGCCCTGAGGGAGATGG + Intergenic
1109638401 13:65153484-65153506 CCAGGTGGTCAGGGTGCAGCTGG + Intergenic
1111770218 13:92586754-92586776 CCAAGTGCCCTGGGAGCAGAGGG + Intronic
1112302040 13:98239646-98239668 CCAAGTGGCCTGGGGGCAGTGGG + Intronic
1113804383 13:113104819-113104841 CCAGGTTGCCCAGGGACTGAGGG - Intergenic
1114646537 14:24259412-24259434 CCGGGTGGGAGGGGGGCAGATGG - Intronic
1117402272 14:55369292-55369314 CCCGGTGGCCCGGGCCCAGAGGG + Exonic
1117746289 14:58872849-58872871 CCAGGTGGCTTGCTGGCAGAGGG + Intergenic
1117803157 14:59465135-59465157 CCAGGTGGGCCGGCCGCGGAGGG + Exonic
1119027450 14:71165418-71165440 CCTGGTGGCCCTGAGGGAGAAGG - Intergenic
1119522065 14:75293973-75293995 CCTGCTGGCCCGTGGGCAGAGGG + Intergenic
1120749985 14:88188240-88188262 CAAGGTGGACCGGGGTTAGAGGG + Intronic
1121304362 14:92896865-92896887 CCTGGGGGCCAGGAGGCAGAAGG + Intergenic
1121636497 14:95457296-95457318 GCAGGTGGCCCGGGAGCATGAGG - Exonic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1122996422 14:105267753-105267775 CAAGGGGGCCTGGTGGCAGAAGG + Intronic
1123024787 14:105419616-105419638 CCTGGTGCCCTGGGGGTAGAGGG - Intronic
1124256258 15:28145189-28145211 CCAGGTGACCAGGCAGCAGAAGG + Intronic
1124465805 15:29938928-29938950 CCAGCTTGCCCTGGGGCATAAGG + Intronic
1124567990 15:30833952-30833974 CCAGGTGGCCAGGCAGCAGAAGG - Intergenic
1124632048 15:31343536-31343558 ACAGGTGGCCTGGGTGCTGATGG + Intronic
1128061947 15:64740915-64740937 GCAGGCCGCCCGGGGGCAGTGGG + Exonic
1128843658 15:70871480-70871502 CCAGGTGGCGGCCGGGCAGAGGG + Intronic
1129297622 15:74608622-74608644 CCTGCTGGCCCAGGGGCAGGTGG - Intronic
1131176056 15:90210506-90210528 CCAGGTGGCCCAGGGTCGGGCGG + Intronic
1131227561 15:90637907-90637929 GCAGATGGCCCGGTGGCAGCTGG - Intronic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1131694127 15:94856606-94856628 CCAGGTGGCCCTGAGGCTGGCGG + Intergenic
1132556351 16:574417-574439 CCAGGGGCACCGGGGGCAGTGGG - Exonic
1132671490 16:1103833-1103855 CCAGGAGGCCCGGAGGCTGCAGG + Intergenic
1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG + Intronic
1132803651 16:1766016-1766038 CCAGAGGACCCGGGCGCAGATGG + Exonic
1132894700 16:2223342-2223364 CCAGGGGGCGGGGCGGCAGAAGG - Intergenic
1133014014 16:2930624-2930646 CCTGGAGGCCCGGCGCCAGAGGG + Exonic
1133841676 16:9415795-9415817 GCAGGTGGCGTGGGGGAAGAGGG + Intergenic
1134044131 16:11088990-11089012 GCAGGTGGCCTGGGGGGAAAGGG - Intronic
1134178324 16:12027013-12027035 CCAGCTGGCGGGGGTGCAGAGGG - Intronic
1134842336 16:17411930-17411952 CTAGGTGGCCCGGAGGCCTAAGG + Intronic
1136113313 16:28078673-28078695 CCAGGGGGTCTGTGGGCAGAAGG - Intergenic
1136136376 16:28259089-28259111 CGAGGTGGCTGGTGGGCAGACGG - Intergenic
1136365817 16:29808759-29808781 CCGGGAGGGCCAGGGGCAGAGGG + Intronic
1137693655 16:50447027-50447049 CCAGTTGGCAGGTGGGCAGAGGG - Intergenic
1139374963 16:66491180-66491202 CCAGGTGGCTCCTGGGCAGGAGG + Intronic
1139940464 16:70601751-70601773 CCAGGTGGGATGGGGACAGAGGG + Intronic
1141231244 16:82169906-82169928 TCAGGAGGCCCGCGGGCGGATGG - Intronic
1141510225 16:84507081-84507103 GCTGGTGCCCCGGGGGCAGTTGG - Intronic
1142220117 16:88850141-88850163 GCAGGTGGGCCGGGGGCACAAGG + Intronic
1142323736 16:89400958-89400980 CCAGGCAGCCCCGGGGCAGACGG - Intronic
1142903187 17:3026178-3026200 TCAGCTGGCCAGGAGGCAGAGGG - Intronic
1143096165 17:4479611-4479633 CCAGGCTGCCAGGAGGCAGAAGG - Intronic
1144004603 17:11088766-11088788 CGAGGGGGCCGGGGGGCAGCGGG - Intergenic
1144623254 17:16831667-16831689 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1144852775 17:18252347-18252369 CCAGGGTGCCCGTGGGGAGAAGG - Intronic
1144883177 17:18441049-18441071 CATGGTGGGCTGGGGGCAGAGGG + Intergenic
1145149053 17:20503337-20503359 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1145935963 17:28715062-28715084 CCAGGTGGCCCAGGAGATGAAGG - Exonic
1146281996 17:31550457-31550479 CCAGGTGGCCCGCGGGGACTCGG + Intergenic
1146831025 17:36069807-36069829 ACAGCGGGCCTGGGGGCAGAGGG - Intronic
1146948916 17:36892376-36892398 CCAGGAGGCCCGAGAGAAGAGGG - Intergenic
1147563340 17:41522074-41522096 CCAGGGGCCCCTGAGGCAGAGGG + Exonic
1147577577 17:41611604-41611626 CATGGTGGGCTGGGGGCAGAGGG - Intronic
1147894183 17:43739906-43739928 CCAGGGGCCCCGGGGGCTGCTGG - Intergenic
1148109628 17:45137198-45137220 TGAGGTGGGCTGGGGGCAGAGGG + Intronic
1148328074 17:46795435-46795457 CCAGCCGGCCCGTGGGCAAAGGG + Intronic
1148460846 17:47838281-47838303 CCAGGCAGCCCTGGGGCTGATGG - Exonic
1148774583 17:50088344-50088366 CCAGGTGGGCCGGGGGCGGGGGG - Intronic
1149657746 17:58319192-58319214 CCAAGGGGCCCGGGTGCAGGCGG + Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150473606 17:65457882-65457904 ACAGGTGGCCCTGGGACAGGTGG - Intergenic
1150487106 17:65551446-65551468 CCAGGAGGCCAGGGGACAGCAGG + Intronic
1151680512 17:75620408-75620430 AGAGGCTGCCCGGGGGCAGAGGG + Intergenic
1151714230 17:75823333-75823355 CGAGCTGGCCCGGGAGCAGCGGG + Exonic
1152253591 17:79224562-79224584 CCAGGTGGCCCTGCGGCCCAGGG + Intronic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152360443 17:79830899-79830921 CCAAGAGGCCCTGGGGCAGGTGG + Intergenic
1153536002 18:6101932-6101954 AAAGGTGGCCTGGGGTCAGATGG - Intronic
1154012673 18:10589199-10589221 CCAGGTGGCCCCGGGCCGGGAGG + Intergenic
1154194990 18:12258946-12258968 CCTGGTGACCCGGGGGGAGAGGG - Intronic
1154955470 18:21250131-21250153 CTAGGAGGCCTGGGAGCAGATGG + Intronic
1160403366 18:78628018-78628040 GCATGTGGCCCGAGGGCTGACGG - Intergenic
1160980823 19:1815841-1815863 CCAGAGGGCTGGGGGGCAGAGGG + Exonic
1161022019 19:2015148-2015170 GCAGGGGTCCCGGGGACAGAGGG + Intronic
1161064148 19:2229321-2229343 CCAGGGGCCCCTGAGGCAGAAGG - Intronic
1161299915 19:3537615-3537637 CCAGGAGGCCGGGGGGCCGGGGG + Intronic
1161504318 19:4635890-4635912 ACAGATGGCCTGGGGACAGATGG + Intergenic
1161597100 19:5156184-5156206 GCAGGTGGCCCAAGGGTAGAGGG - Intergenic
1162111560 19:8402562-8402584 ACAGGTGGCCGGGGACCAGATGG + Exonic
1162125658 19:8498415-8498437 CCACGGGCCCCGGGGGCAGCGGG + Exonic
1162304020 19:9860611-9860633 CCAGGTACCCTGGGGGCAGCTGG - Intronic
1162937141 19:13986912-13986934 CCAGGGAGCCCAGGGGCAGGAGG - Intronic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1163832822 19:19555153-19555175 CCCAGTGGCCCGTGGGCACATGG - Intergenic
1164639461 19:29813072-29813094 CCATGTGACCCAGGGGGAGAAGG - Intronic
1164675398 19:30097192-30097214 CCAGCAGGCCAGTGGGCAGATGG - Intergenic
1166268011 19:41696850-41696872 CCAGATGGCCGGGGTTCAGATGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167158948 19:47755422-47755444 CCAGGTGGCCCTGAGGCTGGCGG + Exonic
1167360122 19:49025635-49025657 GAAGGTGGCCCGGGGGTAGGTGG - Intronic
1167362689 19:49038651-49038673 GAAGGTGGCCCGGGGGTAGGTGG - Intergenic
1167367293 19:49061534-49061556 GAAGGTGGCCCGGGGGCAGGTGG - Exonic
1167508001 19:49881277-49881299 CCAGGAGCCCTGGGGGCAGCTGG - Exonic
1168315739 19:55484083-55484105 CCGGGTGGGCCGGTGGCAGGCGG - Exonic
1168337720 19:55605753-55605775 CCCGGGGGCCCGGGTGCAGCGGG + Intronic
926111741 2:10188174-10188196 CCAGGTGGCTGGGGTGCAGTGGG + Intronic
926223142 2:10949219-10949241 CCTGGAGGACCTGGGGCAGATGG + Intergenic
927679649 2:25131391-25131413 CCAGGTGGCCCAGGAGCTGCTGG - Exonic
927779389 2:25927282-25927304 CCAGGTGGCCTGAGCGCAGGGGG - Exonic
927844323 2:26463562-26463584 CCAGGCGGCCCTGAGGAAGAGGG + Exonic
929604285 2:43224981-43225003 CGAGGCCGCCCGGGGGCTGATGG + Exonic
932490387 2:72116284-72116306 GCAGGTGGCCCTGGGGCTGAGGG - Intergenic
933935321 2:87199169-87199191 CCAGGGTGCCTGTGGGCAGATGG + Intergenic
935668829 2:105538029-105538051 CCAGGTAGCCCTGCAGCAGAGGG - Intergenic
936357827 2:111766730-111766752 CCAGGGTGCCTGTGGGCAGATGG - Intronic
936427680 2:112434574-112434596 CCCGCTGCCCCGGGGGTAGATGG + Intergenic
938072144 2:128314402-128314424 CAAGGTGGCACGGTGTCAGATGG + Intronic
938072885 2:128317725-128317747 TAAGGTGGCCCGAGGGCAGCGGG + Intronic
938408071 2:131043745-131043767 CCTGGTGGCCCAGGAGCAGCAGG + Intronic
942642168 2:178072117-178072139 CCAGCTGGGCCGGTGGCAGCAGG - Exonic
942891246 2:180991550-180991572 CCAGGTGGCCCAAGGGCCGCAGG - Intronic
947549753 2:231037761-231037783 CCGGGCGGCGCGGCGGCAGAGGG + Exonic
948283056 2:236763108-236763130 CCAGGTGTCCTGGGGACAGTCGG - Intergenic
948423100 2:237872479-237872501 CCAGGAGCCCCGGCTGCAGATGG - Intronic
948430320 2:237914328-237914350 CCTGGGGGCCCGGGGGCCGCGGG - Intergenic
948450714 2:238069437-238069459 CCAGGTGCTCCAGGGGCAGCCGG - Exonic
948785310 2:240349465-240349487 GCAGGAGGCCCGGGGACACAAGG - Intergenic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
948866240 2:240776182-240776204 CTGGGTGGCCCAGGGGCAGCAGG - Intronic
1169027388 20:2382336-2382358 CCTGATGGCCCTGGTGCAGAGGG + Intronic
1170766094 20:19291136-19291158 CGAGGTGCCCCTGGGGCTGAGGG + Intronic
1172118126 20:32583726-32583748 CCAGGGCGCCCCGGGCCAGAGGG + Intronic
1172166555 20:32903171-32903193 CCAGGTGGGCCAGGAGGAGAGGG - Intronic
1172610991 20:36252460-36252482 CAAGGTAGCCCTGGGGCTGAGGG + Intronic
1173884279 20:46443704-46443726 CCAGATGGCCCGGGAGCTGCAGG + Intergenic
1174163108 20:48565539-48565561 TCAGGGGGCCCTGGGGCATAGGG - Intergenic
1174287829 20:49484442-49484464 GCAGGTGGCCTGGGTGGAGAGGG - Intergenic
1174340051 20:49889946-49889968 CCTGGTGACGAGGGGGCAGACGG - Exonic
1174475032 20:50790612-50790634 GCAGATGGCGTGGGGGCAGAAGG + Intergenic
1175215250 20:57389184-57389206 CAAGGGGGCCCGGGGGCGGGGGG + Intergenic
1175219524 20:57408982-57409004 GCAGGTGGTGCGGGGGTAGAGGG - Exonic
1175330138 20:58158039-58158061 CCAGGGGCCCTGGTGGCAGAGGG - Intronic
1175633116 20:60558664-60558686 GCAGGTGGCCCGGAGGGAGCAGG + Intergenic
1175792221 20:61746837-61746859 CCAGGTGGCATGGGGGCAGGAGG + Intronic
1175989200 20:62779121-62779143 CCAGGTGGCCCGGTGGGACGAGG - Intergenic
1176023719 20:62975361-62975383 CCAGGAGCCCCAGTGGCAGAAGG + Intergenic
1176222374 20:63975758-63975780 CCAGGAGGCCCAGAGGCAGGAGG - Exonic
1178639904 21:34337383-34337405 TGAGGGGGCCTGGGGGCAGATGG + Intergenic
1179031137 21:37720516-37720538 CCAGGAGGCCTGGGGGCTGGGGG + Intronic
1179297878 21:40079530-40079552 CCAGGTGGGGTGGGGTCAGATGG - Intronic
1179596220 21:42444737-42444759 CCTGGTGGCCCTGGGTCAGCCGG - Intronic
1180094670 21:45550393-45550415 GCAGGTGGCCCATGGGAAGAAGG - Intergenic
1181533567 22:23530532-23530554 TCAGGTGGGCTGAGGGCAGAGGG + Intergenic
1181614149 22:24040754-24040776 GCAGGCTGCCTGGGGGCAGAAGG - Intronic
1182628046 22:31662659-31662681 CCAGGGAGACCGGGGGCAAACGG + Intergenic
1183076878 22:35432867-35432889 GCAGGTGTCTCGGGGGCAGATGG + Intergenic
1183309829 22:37103375-37103397 CCAGGTGGCTGGCGGGCAGGGGG - Exonic
1183704697 22:39469453-39469475 TCAGGTGGCCCAGTGCCAGACGG - Intronic
1183744678 22:39685747-39685769 CCCGGTGGCCTGGGGGGAGGTGG - Exonic
1184414228 22:44342819-44342841 CCATGGTGCCCTGGGGCAGAAGG - Intergenic
1184468811 22:44684074-44684096 CCAGGAGGGCCCGGGCCAGAGGG + Intronic
1184533565 22:45071657-45071679 CCTGGTGGGCTGGGGGCAGTTGG + Intergenic
1184728841 22:46362207-46362229 CCAGGTGGCCCGGGAGCTGCAGG - Exonic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185060963 22:48606757-48606779 CCTGGAGGCCTGGGTGCAGAGGG + Intronic
1185272151 22:49934643-49934665 CCTGGGGGTCGGGGGGCAGAAGG + Intergenic
950016429 3:9757765-9757787 CCAGGAGGGGCAGGGGCAGACGG - Exonic
950103187 3:10370723-10370745 GCAGCTGGCTCAGGGGCAGAAGG + Intronic
950424167 3:12915623-12915645 CCATGTGTCCCAGGTGCAGAAGG - Exonic
951558773 3:23945745-23945767 CCGGGCGGCCCGGGGGGCGATGG - Intronic
952998019 3:38904183-38904205 TCAGGAGGCCCTGGGGAAGAGGG - Intronic
953391182 3:42534764-42534786 CCAGGAGGGCTGGGGGCAGAAGG + Intronic
954361394 3:50124605-50124627 CCAGCTGGTCCCAGGGCAGAGGG - Intergenic
954409937 3:50366037-50366059 CCAGGTTGCCAGGGGGCTGAGGG + Exonic
954753536 3:52826944-52826966 CCCGGTGGCCCTGGGGGAGAAGG + Exonic
958599525 3:96277200-96277222 TCATGTGGCCCGTGGGCCGAAGG + Intergenic
958736583 3:98016317-98016339 CCAGGTGGCAGGGGTGAAGAAGG - Intronic
958892121 3:99794738-99794760 CCAGGGGGCCCTGGGGCCCAGGG - Exonic
960987479 3:123290318-123290340 CCAGGAGGGCCGGGGCCAGGGGG - Intronic
961378404 3:126481991-126482013 GCAGGTGGCCAGGAAGCAGAGGG + Exonic
961531344 3:127542229-127542251 CCAGGTGGCCCCGAGACTGAGGG + Intergenic
961552430 3:127676953-127676975 CCAGGCGGCCTGGGGGCAGTGGG - Exonic
961664949 3:128489037-128489059 CCAGGTGGGTCGGGGGCAGGAGG + Intronic
962607496 3:137044835-137044857 CCAGGTTGCCCAGGCCCAGAGGG + Intergenic
966516785 3:180828812-180828834 CCTGGAGGCCCGGCGGCAGCAGG - Intronic
967946486 3:194807994-194808016 GCAGGAGACCCGGGAGCAGAAGG + Intergenic
968870807 4:3241247-3241269 TCAGCTGGAACGGGGGCAGAAGG - Exonic
968898831 4:3421132-3421154 ACAGGCGGCCCGCAGGCAGAGGG - Intronic
968913196 4:3486031-3486053 CTCGGTGGCCCGGGGGCAGCTGG + Intronic
968951884 4:3699716-3699738 CCTGGAGGGGCGGGGGCAGAAGG + Intergenic
968974544 4:3814363-3814385 TGAGGTGGCCAGGGGGCAGTGGG - Intergenic
969242086 4:5905914-5905936 GCAGGGGGGCGGGGGGCAGAGGG + Intronic
970026060 4:11625322-11625344 CCAGGTGGCCCCGGCATAGAAGG + Intergenic
971178244 4:24302505-24302527 GAAGGTGGCCCTGAGGCAGAAGG + Intergenic
971420734 4:26471920-26471942 CCTGGTCACCCTGGGGCAGAAGG - Intergenic
975219656 4:71799560-71799582 CCAGGGGGACCTGGGGCTGATGG + Intronic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
981471337 4:145138587-145138609 CCAGGTAGGCCTGGTGCAGAGGG + Exonic
985490576 5:176125-176147 CCAGGAGGCTGGGGGCCAGAGGG - Intronic
985559276 5:574269-574291 CCAGGTGGGAAGGGAGCAGAGGG + Intergenic
985814674 5:2117747-2117769 CCAGGTCCCCCGGGAGTAGATGG + Intergenic
986043145 5:4012324-4012346 CCAGGTGTCCTGGAGACAGAAGG + Intergenic
986789274 5:11144411-11144433 GCAGGTGGACCGGAGGCAGTGGG - Intronic
989146720 5:38257759-38257781 CCAGCTGGGCCTGGGGCAGGGGG - Intergenic
990370570 5:55114310-55114332 CCCTGTGGCCTGGGGGAAGAAGG + Exonic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
997063011 5:130529367-130529389 CCAGGTGGGCCAGGGGCTGTTGG - Intergenic
997367420 5:133334950-133334972 CCAGGACGCCCTGGGGCAGTGGG - Intronic
998813101 5:145986182-145986204 CCAGCTGGCCTGGGGGCTGGAGG - Intronic
999077762 5:148813107-148813129 GCAGGTGGCCCACGGGCAGCAGG - Intergenic
999369925 5:151048548-151048570 ACAGGTGACCCTGGGGCACAAGG + Intronic
1000388823 5:160701734-160701756 CCAGGAGGCACTGGGGCAGAGGG - Intronic
1000388854 5:160701864-160701886 CCAGGAGGCACTGGGGCAGAGGG - Intronic
1002103403 5:176868430-176868452 CCAGGTGGCCAGGGGGCCATGGG - Intronic
1002345374 5:178544744-178544766 CCCAGTGGCACGGGGGCAGCAGG - Intronic
1002842167 6:915590-915612 GCAGGTGGCCAAGGGGCAGCAGG - Intergenic
1003528379 6:6917241-6917263 CCAGGTGGAACGTGGGCAAATGG - Intergenic
1005894185 6:30163897-30163919 CCAGCGGGCCCAGGGGCACAGGG - Exonic
1006170266 6:32088100-32088122 CCAGGTGGGGCTGGGGCACAGGG - Intronic
1006286934 6:33103970-33103992 CCATGGGCCCCGGGGGCTGAAGG - Intergenic
1006841106 6:37028285-37028307 ACACGTGGCCTGGGCGCAGATGG - Exonic
1008368603 6:50709545-50709567 GAAGGGGGCCCGAGGGCAGATGG + Intergenic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1016461744 6:144285800-144285822 CGAGGAGGCCCGCGGGCAGCAGG + Intronic
1016833621 6:148455944-148455966 CCAGCTGCCCTGGGGGCAGCAGG - Intronic
1017873035 6:158502561-158502583 CCAGCTGGCCCAGGGGCGGGGGG + Exonic
1018207760 6:161451495-161451517 TCAGGTGGGCCGTGGGCAGGTGG - Intronic
1018910777 6:168100071-168100093 CCTGGTTGGCCGGGGGCACAGGG - Intergenic
1019194048 6:170271095-170271117 GCAGATGGCCAGGGGGCAGGCGG + Intergenic
1019262181 7:87845-87867 CCTGATGGCCCTGGGGCAGGTGG - Intergenic
1019476793 7:1248270-1248292 CCAAGCGGCCCAGGGGCAGGCGG - Intergenic
1019511834 7:1421616-1421638 CCCGAGGGCCAGGGGGCAGATGG + Intergenic
1021669665 7:23022666-23022688 CCAGCAGGGCTGGGGGCAGAGGG + Intergenic
1022316170 7:29247439-29247461 GCATGTGGCCCTGGGGCAAATGG - Intronic
1023951249 7:44847936-44847958 CCGGGTGGGCCGGGGGCACGGGG - Intronic
1024565153 7:50674473-50674495 ACAGGTGTCCCCGAGGCAGAGGG - Exonic
1025089692 7:56051881-56051903 CGAGGTGGCCCGAGCGCAGGCGG + Exonic
1026915127 7:74115541-74115563 GCAGGTGGGGAGGGGGCAGAGGG + Intronic
1028556803 7:92134193-92134215 CCAGGTGGCCGGCGGCCAGACGG + Exonic
1029202970 7:98851383-98851405 CCATGTGGCACTGGAGCAGAAGG + Intronic
1029365488 7:100113631-100113653 CCAGGGGCACCCGGGGCAGAGGG + Exonic
1029413976 7:100431525-100431547 GAAGGGGACCCGGGGGCAGAGGG + Exonic
1030298106 7:107948801-107948823 CCCGGTGGCACGAGGGCAGCAGG - Intronic
1030659842 7:112206897-112206919 CCAGGTGGCCCCAGAGCTGAAGG - Intronic
1032793105 7:135256918-135256940 CCAAGTGGCTCTGGGGCAGGAGG + Intronic
1034276892 7:149827793-149827815 GCAGGTGGCCCCGGGGGAGCTGG + Intergenic
1034410085 7:150936245-150936267 CCATGTGCTCCGGGGCCAGAGGG - Intergenic
1034429547 7:151034308-151034330 CCAGCTGGCCCAGGAGCAGGGGG - Exonic
1034592347 7:152152370-152152392 CCAGGTGGCCCAGGTGCAGCGGG + Intronic
1034627338 7:152503627-152503649 CCAGGTGGCCAGGTGGGAGTGGG + Intergenic
1035224767 7:157427037-157427059 CCAGGTCGCACAGTGGCAGACGG + Intergenic
1036442024 8:8789862-8789884 CTCAGTGGCCCTGGGGCAGAGGG - Intronic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037829228 8:22178166-22178188 CCAGGTGCCCTGGGTGCACACGG - Intronic
1038142130 8:24857248-24857270 CCAGGTGGCCAGGGGGCCTCAGG + Intergenic
1039892926 8:41696802-41696824 CCAGCTGGCCCGGGAGGAGGTGG - Intronic
1040023443 8:42761047-42761069 CCACGTGGCCCAGGGGAAGCTGG - Intronic
1040408745 8:47134157-47134179 CCAGGTGGCACAGGTGCTGAGGG - Intergenic
1040530001 8:48259013-48259035 CTAGCTGGCCCTGGGGCAAAGGG - Intergenic
1044637586 8:94342041-94342063 CTGGGTGGCCTGGGGGCAGGGGG - Intergenic
1045510247 8:102807590-102807612 CCACCTGTCCCGGGGGCGGAAGG - Intergenic
1048899315 8:139022476-139022498 CCAGGTGCCTGGGGGTCAGAAGG + Intergenic
1049090565 8:140511107-140511129 CCACGAGGCCCGGAGTCAGAGGG + Intergenic
1049212133 8:141391794-141391816 CCAGGTCGGCCTGGGGCAGGCGG - Intergenic
1049279719 8:141738112-141738134 CCAGGAGCCCCGGGGGGAGATGG + Intergenic
1049279737 8:141738171-141738193 CCAGGAGCCCCGGGGGGAGACGG + Intergenic
1049407431 8:142457950-142457972 CCAGGGGGCTGGGAGGCAGACGG - Intronic
1049473246 8:142785551-142785573 CCAGGTGTCCCTGGGGCTGGGGG - Intronic
1049653793 8:143789016-143789038 CCAGGAGGCCCAGAGGCACAAGG + Intergenic
1049658282 8:143808497-143808519 CCGGGTGGCCAGGGGCCAGTGGG + Intronic
1049661187 8:143820359-143820381 GCAGGTGGCGTGGGCGCAGACGG + Intronic
1049796156 8:144498153-144498175 CCGGGAGGCCTGGAGGCAGAGGG + Intronic
1049796461 8:144499389-144499411 CCAGGTGGCTTGGGAGGAGAGGG + Intronic
1050382310 9:5042709-5042731 CCAGGTGGGCCTGGGCAAGATGG - Intronic
1051634112 9:19166137-19166159 ACAGGGGGCCAGGGGGCAGGTGG - Intergenic
1053168426 9:35861035-35861057 CCAGGTGGCCCCTGGTCTGAAGG + Intergenic
1053370980 9:37561426-37561448 CCAGGTGGCCCAGAGGCATGTGG - Intronic
1053669491 9:40346214-40346236 CCAGGTGGCCCAGTGGCCCACGG - Intergenic
1054515123 9:66030077-66030099 CCAGGTGGCCCAGTGGCCCACGG + Intergenic
1054810384 9:69429475-69429497 CCAGGTGCCCTGGGGGGAAAGGG - Exonic
1056966296 9:91165347-91165369 TCAGGGGGCGCGGGGGCAGTGGG + Intergenic
1057169825 9:92955042-92955064 TCAGGTGGCCAAGGAGCAGAGGG + Intronic
1057214130 9:93218834-93218856 CAAGGGGTCCCTGGGGCAGAGGG - Intronic
1060794991 9:126507326-126507348 CCAGGTGGCCCCGGTGGGGAGGG + Intergenic
1060967761 9:127721189-127721211 CCAGGTGTCCCCAGGGCAGGGGG + Intronic
1061193647 9:129095962-129095984 CCAGGTGCCCCGGGGGCTGGAGG - Intronic
1061466729 9:130786221-130786243 CTGGGGGGCCCTGGGGCAGAGGG + Intronic
1061994177 9:134175596-134175618 CCCGGGGGCCCGGGGCAAGACGG - Intergenic
1062082906 9:134633902-134633924 GGAGGTGGCCTGGGGGCTGAGGG - Intergenic
1062144345 9:134980625-134980647 CTGGGTGGCCGGGGGGCAGGTGG + Intergenic
1062192825 9:135256486-135256508 CCAGGTGGAGAGGAGGCAGAGGG - Intergenic
1062400569 9:136370813-136370835 CCTGGTTTCCCGGGGGCAGCGGG + Intronic
1062428537 9:136516979-136517001 TCAGGAGGCCGGGGTGCAGACGG + Intronic
1062428561 9:136517040-136517062 TCAGGAGGCCGGGGTGCAGACGG + Intronic
1062428608 9:136517157-136517179 TCAGGAGGCCGGGGTGCAGATGG + Intronic
1062464039 9:136673417-136673439 CCCGATGGCCCAGGAGCAGATGG - Exonic
1062571223 9:137186277-137186299 CCAGGTGACCCGGGAGAGGATGG - Exonic
1062647322 9:137555287-137555309 GCAGGTGGCCAGGAGGCTGAAGG + Exonic
1185750695 X:2608385-2608407 ACAGGTGGCCTGGGGAGAGACGG + Intergenic
1190719237 X:53133526-53133548 CCAGGTGAGCCTGGCGCAGACGG + Intergenic
1190856132 X:54296724-54296746 CCAGGTGAGCCTGGCGCAGATGG + Intronic
1191760033 X:64636642-64636664 TCAGGTGGCAGGGTGGCAGAAGG + Intergenic
1192509644 X:71714238-71714260 CCAGGTGCCCCGCAGGGAGAGGG + Intergenic
1192517053 X:71767315-71767337 CCAGGTGCCCCGCAGGGAGAGGG - Intergenic
1194032928 X:88837886-88837908 CCAGATGGCCCTGGGGCGGGCGG - Intergenic
1197774282 X:130109934-130109956 CCAGAAGCCCCGGGGGCAGTCGG + Intronic
1199718648 X:150525801-150525823 CCATGAGGCCCTGGGGCAGCTGG - Intergenic
1200248040 X:154536169-154536191 CCAGGTCACCCTGTGGCAGAGGG + Exonic