ID: 1122972742

View in Genome Browser
Species Human (GRCh38)
Location 14:105158977-105158999
Sequence GCACTGGGACGTGCGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122972742_1122972749 -2 Left 1122972742 14:105158977-105158999 CCACCCCACGCACGTCCCAGTGC 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1122972749 14:105158998-105159020 GCCTCGGCCTCATCCAGCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 98
1122972742_1122972753 8 Left 1122972742 14:105158977-105158999 CCACCCCACGCACGTCCCAGTGC 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1122972753 14:105159008-105159030 CATCCAGCTAAGGACAGGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 231
1122972742_1122972751 3 Left 1122972742 14:105158977-105158999 CCACCCCACGCACGTCCCAGTGC 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1122972751 14:105159003-105159025 GGCCTCATCCAGCTAAGGACAGG 0: 1
1: 0
2: 0
3: 12
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122972742 Original CRISPR GCACTGGGACGTGCGTGGGG TGG (reversed) Intronic
900083933 1:877767-877789 GGACTGGGAGGTGTGTGGGAGGG + Intergenic
900621443 1:3589372-3589394 CAAATGGGACGGGCGTGGGGTGG - Intronic
902520353 1:17012082-17012104 CCACTGGGACGTGCTGGCGGGGG - Intergenic
902572703 1:17356822-17356844 GCAGAGGGACGGGGGTGGGGCGG + Intronic
903034306 1:20484823-20484845 GCGTGGGGACCTGCGTGGGGAGG - Intronic
905393538 1:37653032-37653054 GCATTGGGAGGTGTGGGGGGTGG - Intergenic
906209072 1:44002361-44002383 TCACTGGGCTGCGCGTGGGGAGG - Exonic
906212740 1:44021211-44021233 GCACTAGGGGGTGGGTGGGGTGG - Intronic
906343958 1:45003783-45003805 GCACATGTACGTGTGTGGGGAGG + Intronic
906818127 1:48900049-48900071 GCAAAGGGATGTGAGTGGGGTGG + Intronic
908518094 1:64913954-64913976 GCACTGGAGGGTGCGTTGGGGGG + Intronic
916143660 1:161721864-161721886 GAACTGGGGCGTGGCTGGGGAGG + Intronic
919071791 1:192765162-192765184 GCACTGGGAGTTGCATGGGATGG - Intergenic
919918007 1:202150967-202150989 GCACTGGGACATGTGCAGGGAGG - Intronic
920092120 1:203462229-203462251 GCACTGGGAGGTGGGTGGCATGG + Intergenic
920435065 1:205942232-205942254 GCTCTGGGAAGTGCCTGGGAAGG + Intronic
922704006 1:227779385-227779407 TCACTGGGCGGAGCGTGGGGAGG + Intronic
922749226 1:228062910-228062932 GCCCTGGGCAGTGAGTGGGGTGG - Intergenic
1062763303 10:44175-44197 GGACTGGGAGGTGGGTGGGAGGG - Intergenic
1062832864 10:617561-617583 GCAATGGGAGGTGGGTGGAGTGG - Intronic
1063201092 10:3785694-3785716 TGACCGGGACGGGCGTGGGGTGG - Intergenic
1069034212 10:63630516-63630538 GCACGGTGACGGGGGTGGGGCGG - Intergenic
1073266113 10:102229477-102229499 GCCCTGGGATGGGAGTGGGGCGG + Exonic
1074818547 10:117163035-117163057 GCACGGGGACTTGCGTGGGGCGG - Intergenic
1076190436 10:128479559-128479581 GCACTGAGATGGGCCTGGGGTGG - Intergenic
1077092872 11:787634-787656 GCAGTGGGACGGACCTGGGGTGG - Exonic
1077391699 11:2303351-2303373 GACCTGGGATGTGGGTGGGGAGG + Intronic
1078630763 11:13001748-13001770 GAACTGGGTGGTGCGGGGGGTGG - Intergenic
1082001281 11:47394924-47394946 GCAATGGGCCGGGGGTGGGGAGG - Intergenic
1083614581 11:64019899-64019921 GCACGGGGACGTGCATGATGAGG + Intronic
1083742030 11:64716287-64716309 GGACTGGGATGGGGGTGGGGCGG - Intronic
1084668649 11:70592293-70592315 GGACTGGGTCCTGCCTGGGGAGG + Intronic
1085884967 11:80511066-80511088 ACACTGGGGCCTGCCTGGGGTGG + Intergenic
1089629626 11:119776235-119776257 GCACTGGGAAGTGTTTGGGGAGG - Intergenic
1091001221 11:131911723-131911745 GCACTGAGGCGTGCCTGGGTTGG + Intronic
1094813183 12:34161934-34161956 GGACTGGGAGGTGGGTGGGAGGG - Intergenic
1096500606 12:52062084-52062106 GCACTGGGCCCAGCGTGGGTGGG - Intergenic
1096747187 12:53736742-53736764 TCAATGGGACGTGTGTGGGAGGG + Intergenic
1096784606 12:54009832-54009854 GCACAGGCACGGGGGTGGGGCGG - Intronic
1097752682 12:63374851-63374873 ACACTGGGACCTGTGTGTGGAGG - Intergenic
1102035498 12:109768616-109768638 GCACTGGGCCGTGCTTGGCAGGG - Exonic
1102871903 12:116420352-116420374 GCTCTGGGATGTGTCTGGGGTGG - Intergenic
1103713340 12:122929146-122929168 GCACAGGGGCGGGTGTGGGGAGG + Exonic
1103997992 12:124842418-124842440 ACCCTGGGAGGTGTGTGGGGAGG - Intronic
1105700861 13:22935075-22935097 GTTCTGGGACCTACGTGGGGTGG + Intergenic
1106336965 13:28792260-28792282 GGACTGGGAGGTGAGTGGTGTGG + Intergenic
1107995004 13:45851010-45851032 GGACTTGGACGTCGGTGGGGTGG - Intronic
1110114825 13:71799975-71799997 GCACTAGGAGTTACGTGGGGTGG + Intronic
1111445830 13:88345428-88345450 GCACGGGGGGGTGCGCGGGGGGG + Intergenic
1112328834 13:98461951-98461973 GCGCTGGGACGTTCAGGGGGAGG + Intronic
1113539984 13:111099457-111099479 GCTCTGGGATGTGAGTGGGGTGG + Intergenic
1113993226 14:16045382-16045404 GACGTGGGACGTGAGTGGGGTGG - Intergenic
1118186464 14:63542868-63542890 GGACCGGGACGTGCAGGGGGAGG + Exonic
1119642945 14:76328542-76328564 GCCCTGGGAGGTGTGTGGGGCGG - Intronic
1120548096 14:85834660-85834682 ACACTGGGGCCTGTGTGGGGTGG + Intergenic
1121413577 14:93763796-93763818 TCACTGGGGAGAGCGTGGGGCGG - Intronic
1122707431 14:103629757-103629779 GCAGTGGGACGCGGATGGGGAGG - Intronic
1122972742 14:105158977-105158999 GCACTGGGACGTGCGTGGGGTGG - Intronic
1123964813 15:25444327-25444349 GAACTGGGATTTGCGTGGGGCGG - Intergenic
1124710238 15:32003729-32003751 CCACTGGGTGGTGGGTGGGGTGG - Intergenic
1127785026 15:62348201-62348223 GCACTGGGCTGTGGGTGGAGAGG + Intergenic
1128553597 15:68614981-68615003 GCACTGGGATGTGAGAGGGTGGG + Intronic
1129737681 15:77975120-77975142 GCAATGAGCCGTGGGTGGGGTGG + Intergenic
1130701404 15:86186207-86186229 GCGCTGGGACTTGCAGGGGGCGG + Intronic
1131034053 15:89209708-89209730 GCAGTCTGACGTGTGTGGGGTGG - Intergenic
1131529564 15:93180012-93180034 ACACTGGGCCGGGCGTGGAGAGG + Intergenic
1132543377 16:521750-521772 GGCCTGGGAAGTGCGTGGGGAGG - Exonic
1133026471 16:2990946-2990968 ACACTGGGACAGGTGTGGGGCGG - Intergenic
1133069275 16:3235083-3235105 GCACTCGGAAGGGCGAGGGGAGG - Exonic
1133130567 16:3673953-3673975 GGACTGGGGTGTGCCTGGGGAGG - Intronic
1135822070 16:25693074-25693096 GCACCCGGACGTGCGGGCGGTGG + Exonic
1136273788 16:29165958-29165980 GCACTGGGCTGAGGGTGGGGTGG + Intergenic
1137553547 16:49456232-49456254 GCACTGAGACCTTCGTGGGGTGG - Intergenic
1138025364 16:53518055-53518077 GCACTTGTGCGTGTGTGGGGAGG + Intergenic
1138299036 16:55911045-55911067 GCACTGGCAGATGAGTGGGGAGG - Intronic
1141954385 16:87360773-87360795 GCACAGGGAAGTACATGGGGTGG - Intronic
1142077331 16:88127703-88127725 GCACTGGGCTGAGGGTGGGGTGG + Intergenic
1142262230 16:89048425-89048447 GGGCTGGGACGCGCGGGGGGAGG - Intergenic
1143223779 17:5282750-5282772 GCAGAGGGAAGGGCGTGGGGAGG + Intronic
1143482584 17:7236196-7236218 TCACTGGGGGGTGCCTGGGGAGG + Exonic
1143706139 17:8698842-8698864 GAAGTGGGAAGTGCGTGGGCGGG + Intergenic
1147262063 17:39214502-39214524 GCACTGGGACGGGAATGGAGAGG + Intronic
1147327008 17:39674493-39674515 GCACTGGGAGGAGTATGGGGTGG - Intronic
1147791478 17:43016578-43016600 ACACAGGGATGTGCCTGGGGGGG - Intronic
1148747003 17:49924141-49924163 GCAGTGGGAGCTGTGTGGGGAGG - Intergenic
1149491121 17:57085701-57085723 GGACAGTGACGCGCGTGGGGAGG - Exonic
1152753670 17:82078113-82078135 GCGCTGGGACTGGCGGGGGGGGG - Intergenic
1152956213 18:44506-44528 GGACTGGGAGGTGGGTGGGAGGG - Intergenic
1153027286 18:683341-683363 GCGCTGGGATGTGCCTGAGGCGG - Exonic
1153506752 18:5808287-5808309 ACACTGGGACCTGTCTGGGGTGG - Intergenic
1154485313 18:14867656-14867678 GAACTGGTACTTGGGTGGGGAGG + Intergenic
1155044414 18:22091290-22091312 GCACTGGCATGTGGATGGGGGGG + Intronic
1157985609 18:52434810-52434832 CCAGAGGGACGGGCGTGGGGAGG - Intronic
1161027474 19:2043184-2043206 GCTCTAGGACGTTCCTGGGGTGG + Exonic
1161059437 19:2207725-2207747 GCAGTGTGACGTGGGCGGGGTGG - Intronic
1161133773 19:2607736-2607758 CCACTGGGAGGGGCGGGGGGCGG - Intronic
1161284004 19:3459613-3459635 GCAATGGGGCGGGGGTGGGGTGG - Intronic
1163227445 19:15974375-15974397 GCACTGGGTCTGGTGTGGGGAGG - Intergenic
1164593643 19:29519792-29519814 GCAGTGGGTCCTGCCTGGGGAGG - Intergenic
1165174084 19:33914426-33914448 GCACTGGGAGGTGGCAGGGGCGG + Intergenic
1165995946 19:39844297-39844319 GTACTGGCATGTGCTTGGGGCGG + Intronic
1168401499 19:56088244-56088266 GCACGGGGACGGGCTCGGGGCGG - Exonic
930033685 2:47072843-47072865 ACACTGGGAAGTGGGTAGGGTGG - Intronic
930177545 2:48315345-48315367 GCACGGGGAGGTGCCGGGGGCGG + Intronic
931008705 2:57882401-57882423 GCACTGGGAGTAGGGTGGGGAGG - Intergenic
932080665 2:68711675-68711697 ACACTGGGGCCTGCGGGGGGTGG - Intronic
933760006 2:85666565-85666587 GCACAGGGGCCTGCGTGGGGAGG + Intronic
934841690 2:97628010-97628032 GCACTGGGAAGTGGGTGGACAGG + Intergenic
934937572 2:98476553-98476575 GCCCTGGGGTGTGTGTGGGGAGG + Intronic
938538468 2:132265484-132265506 GACGTGGGACGTGAGTGGGGTGG + Intergenic
947635804 2:231680370-231680392 GGAGTGGGACGTGCCTGGGCAGG + Intergenic
948813680 2:240499054-240499076 GCACGTGGAAGTGTGTGGGGCGG + Intronic
948839555 2:240642336-240642358 GGGCCGGGACGTGGGTGGGGAGG - Intergenic
1168786634 20:545021-545043 GCACTGGAACGAGGGTGAGGAGG + Intergenic
1170578767 20:17682510-17682532 GCGCTCGGCCGTGCGCGGGGCGG + Intergenic
1171907872 20:30915233-30915255 GACGTGGGACGTGAGTGGGGTGG - Intergenic
1171948582 20:31400631-31400653 GCAATGGGAAGTGGGTGGGAAGG - Intergenic
1172160306 20:32863342-32863364 GCACTGGAAGGTGGGTGGGGAGG + Intronic
1173454100 20:43189782-43189804 GGACTGGGGCGGGCGCGGGGTGG + Exonic
1174494466 20:50930417-50930439 GCATGGGGGTGTGCGTGGGGGGG + Intronic
1174583805 20:51592221-51592243 GAACTGGGAGGTGAGTGCGGAGG - Intergenic
1175278667 20:57788326-57788348 GCACTGGGAGGTGGCTGGAGGGG - Intergenic
1176723954 21:10414564-10414586 GAACTGGTACTTGGGTGGGGAGG + Intergenic
1176796021 21:13371820-13371842 GAACTGGTACTTGGGTGGGGAGG - Intergenic
1178913178 21:36692907-36692929 GGGCTGGGACCCGCGTGGGGCGG - Intergenic
1179515491 21:41903685-41903707 GCACTGGGCCTGGCGTGAGGAGG - Intronic
1180314042 22:11262131-11262153 GACGTGGGACGTGAGTGGGGTGG + Intergenic
1180341317 22:11621403-11621425 GACGTGGGACGTGAGTGGGGTGG - Intergenic
1180824831 22:18855035-18855057 ACAGTGGGACGGGGGTGGGGTGG + Intronic
1181968435 22:26672515-26672537 TCTCTGGGACGTGAGTGTGGAGG + Intergenic
1182583409 22:31328710-31328732 GCGCTGGGCTGGGCGTGGGGAGG - Intronic
1183392232 22:37552249-37552271 TCACTGTGAGGTGGGTGGGGTGG - Intergenic
1184572131 22:45332090-45332112 GCACTGGTGAGTGTGTGGGGTGG + Intronic
1184732775 22:46379920-46379942 GCACTGGAACGGGGGTGTGGTGG - Intronic
1185241709 22:49750523-49750545 GCACTGGGCCTGGCATGGGGGGG - Intergenic
1203274977 22_KI270734v1_random:80940-80962 ACAGTGGGACGGGGGTGGGGTGG + Intergenic
951879165 3:27463645-27463667 GCACTGGGATGAGGATGGGGTGG + Intronic
952866937 3:37861246-37861268 GGCCTGGGACGTGAGTGCGGAGG - Intergenic
953912149 3:46898607-46898629 GCACGGGGACGCGCGGTGGGTGG - Intronic
955386871 3:58487427-58487449 GCACTGGGAAGTGAGGGGGAGGG + Intergenic
961827056 3:129604715-129604737 GCAGTGGGATGTGCGTGGCAGGG - Intronic
968663369 4:1807986-1808008 GCCCTGGGCGGGGCGTGGGGGGG + Exonic
969058240 4:4415360-4415382 GCACTTGGAGGAGCTTGGGGAGG - Intronic
969247489 4:5945087-5945109 GCACTGGAGCGTGCATGGGGAGG + Intronic
969263247 4:6046778-6046800 GCTGTGGGTCGGGCGTGGGGAGG + Intronic
969655815 4:8497907-8497929 CCACTGGGGCTGGCGTGGGGGGG + Intergenic
972666750 4:41172225-41172247 GGACTGGAATGTGCCTGGGGCGG - Intronic
973777267 4:54254972-54254994 GCACTGGGCCGGGTGGGGGGCGG + Intronic
978275312 4:106942253-106942275 GTACTGGGATGTGGGTGGTGTGG - Intronic
984778841 4:183505809-183505831 GCTTTGGAACGTGCGGGGGGAGG + Intronic
985440322 4:189979321-189979343 GGACTGGGAGGTGGGTGGGAGGG - Intergenic
985538054 5:475456-475478 GCACTGGGACCTGGGGGGGTGGG - Intronic
987303276 5:16616455-16616477 TCACAGGGACGTGCGTCCGGAGG + Intronic
987787809 5:22524966-22524988 ACACTGGGACGGTTGTGGGGTGG - Intronic
988194663 5:27988376-27988398 GTATTTGGAAGTGCGTGGGGAGG + Intergenic
991363750 5:65847043-65847065 ACACTGGGACTTTTGTGGGGCGG - Intronic
993017505 5:82551708-82551730 TCACTGGGCCGGGGGTGGGGTGG + Intergenic
995951156 5:117715793-117715815 GCACTGGAACTAGCGTGGGGTGG + Intergenic
996921063 5:128768244-128768266 AAATTGGGACGAGCGTGGGGAGG - Intronic
997585300 5:135039994-135040016 GCCCTGGGACCTCCGTGGAGGGG + Intronic
998142944 5:139710022-139710044 GTGCTGGGACGGGCGTGGGGGGG + Intergenic
998383534 5:141742704-141742726 GCAGTGGGAAGTGGGAGGGGAGG + Intergenic
1000654228 5:163856641-163856663 GTACTGGGACATGCATGGGGAGG - Intergenic
1001321000 5:170681329-170681351 GCACTGGGGCGCGACTGGGGAGG - Intronic
1002617417 5:180464386-180464408 GGCCTTGGAGGTGCGTGGGGCGG - Intergenic
1006191512 6:32212577-32212599 GCAGTGGGAATTGCGTGGGCAGG + Exonic
1006429802 6:33988623-33988645 ACTCTGGGAGGGGCGTGGGGTGG - Intergenic
1006644455 6:35506219-35506241 GCACTGGGACCTGCTGGGAGCGG - Intronic
1006792805 6:36714752-36714774 GCACTGGGAAGTTCCTGGCGTGG - Intronic
1013748000 6:113368412-113368434 TCACTGGGATGTGTGTGGGGAGG - Intergenic
1017675318 6:156807139-156807161 TCACTGGGTGGGGCGTGGGGGGG - Intronic
1018690226 6:166338665-166338687 GCACTGGGGAGAGGGTGGGGAGG + Intronic
1019164127 6:170087618-170087640 GCAGTGGGAGGAGCGTGGTGTGG + Intergenic
1019494497 7:1331447-1331469 ATACAGGGAAGTGCGTGGGGAGG - Intergenic
1019516636 7:1443051-1443073 GCACTGGCTCGGGGGTGGGGAGG - Intronic
1025398665 7:59509533-59509555 ACACTGGGGCGTGTGTTGGGTGG + Intergenic
1026180894 7:68039811-68039833 GCACAGGGACGTGTGTGTGTGGG + Intergenic
1027233683 7:76285875-76285897 GCACTGGGAGAGGCGAGGGGCGG + Exonic
1027250046 7:76393342-76393364 GCACTGCGGCGTGGGAGGGGCGG - Intronic
1031605124 7:123759906-123759928 ACACTGGGACCTGTGGGGGGTGG - Intergenic
1032257047 7:130305820-130305842 GCACTGGGAAAGGCGTGAGGCGG + Exonic
1034203526 7:149296708-149296730 GCACTGGGGGTTGAGTGGGGAGG - Intronic
1036430473 8:8685256-8685278 GGACAGGGACGTGGGAGGGGAGG - Intergenic
1036688979 8:10929478-10929500 CCTCTGGGAGGTGCGTGGGCAGG - Intronic
1036706905 8:11053052-11053074 GCACAGGGTGGCGCGTGGGGGGG - Intronic
1037481975 8:19313818-19313840 GCACTGGTAGGTGCTGGGGGTGG + Exonic
1040878025 8:52173552-52173574 GCACTGGGACAGGCTTGGGTAGG - Intronic
1047247047 8:123155198-123155220 GCATTGGGAGGTGAGTGAGGAGG - Intergenic
1047871067 8:129082776-129082798 ACACTGGGACCTGTCTGGGGAGG + Intergenic
1049018980 8:139941015-139941037 TCACTGGGACATACCTGGGGTGG + Intronic
1057259065 9:93574222-93574244 GGGCTGGGAGGTGGGTGGGGTGG + Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1057752402 9:97803484-97803506 GCGCTGGGCCGGGCCTGGGGAGG - Intergenic
1058651154 9:107176802-107176824 GGACTGGGATGTGCGTGTGTTGG + Intergenic
1060733059 9:126050013-126050035 CCCCTGGGACGGGGGTGGGGGGG + Intergenic
1061035885 9:128114170-128114192 GCCCTGGGGCGGGCGTGGTGGGG + Intergenic
1061082953 9:128383176-128383198 GGACTGGGAGGGGTGTGGGGAGG - Intronic
1061241855 9:129379033-129379055 GCACTGGGAGATGAGTGGGTGGG + Intergenic
1061590300 9:131593675-131593697 GCACTGGGGGCTGCGTGGGGTGG + Intronic
1062331962 9:136048818-136048840 GCACAGGGATATGCGTGGTGGGG + Intronic
1062480190 9:136747533-136747555 GCCCTGGTACGTGCTTGCGGTGG - Exonic
1062600407 9:137316537-137316559 GCACTGGGAGCTGCGAGGGTCGG - Intronic
1062741989 9:138180270-138180292 GGACTGGGAGGTGGGTGGGAGGG + Intergenic
1203362354 Un_KI270442v1:228250-228272 GACGTGGGACGTGAGTGGGGTGG + Intergenic
1186203023 X:7173096-7173118 ACACTGGGGCCTGTGTGGGGAGG - Intergenic
1187552909 X:20323904-20323926 GCAATGGGAGGTGGGTGTGGTGG - Intergenic
1189280956 X:39820075-39820097 GCACCGGGACTGGGGTGGGGAGG - Intergenic
1189666866 X:43365163-43365185 GCACTGGGAGATGCCTGGGAAGG - Intergenic
1195354025 X:104021393-104021415 GGTCTGGGACGTGGGTGGAGAGG + Intergenic
1198310336 X:135422935-135422957 GCACTGGGGCGTGGGCGGGAGGG - Intergenic
1198442345 X:136675335-136675357 ACACTGGGACCGGGGTGGGGGGG + Intronic
1200796794 Y:7348323-7348345 GCACTGGGGCGTGTGAGGGTTGG - Intergenic
1201075893 Y:10188006-10188028 GACGTGGGACGTGAGTGGGGTGG - Intergenic
1201758323 Y:17513983-17514005 GGACTGGGAGGTGGGTGGGAGGG - Intergenic
1201843232 Y:18392007-18392029 GGACTGGGAGGTGGGTGGGAGGG + Intergenic