ID: 1122974983

View in Genome Browser
Species Human (GRCh38)
Location 14:105167413-105167435
Sequence CACCGCGGCCTGCCCGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 310}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122974977_1122974983 0 Left 1122974977 14:105167390-105167412 CCCAGCACGCGCTGCGCACATGC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG 0: 1
1: 0
2: 0
3: 27
4: 310
1122974972_1122974983 16 Left 1122974972 14:105167374-105167396 CCTGCCCTAGACCAGCCCCAGCA 0: 1
1: 0
2: 2
3: 50
4: 405
Right 1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG 0: 1
1: 0
2: 0
3: 27
4: 310
1122974978_1122974983 -1 Left 1122974978 14:105167391-105167413 CCAGCACGCGCTGCGCACATGCC 0: 1
1: 0
2: 0
3: 10
4: 148
Right 1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG 0: 1
1: 0
2: 0
3: 27
4: 310
1122974976_1122974983 1 Left 1122974976 14:105167389-105167411 CCCCAGCACGCGCTGCGCACATG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG 0: 1
1: 0
2: 0
3: 27
4: 310
1122974975_1122974983 5 Left 1122974975 14:105167385-105167407 CCAGCCCCAGCACGCGCTGCGCA 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG 0: 1
1: 0
2: 0
3: 27
4: 310
1122974973_1122974983 12 Left 1122974973 14:105167378-105167400 CCCTAGACCAGCCCCAGCACGCG 0: 1
1: 0
2: 3
3: 11
4: 116
Right 1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG 0: 1
1: 0
2: 0
3: 27
4: 310
1122974974_1122974983 11 Left 1122974974 14:105167379-105167401 CCTAGACCAGCCCCAGCACGCGC 0: 1
1: 0
2: 3
3: 19
4: 207
Right 1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG 0: 1
1: 0
2: 0
3: 27
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122974983 Original CRISPR CACCGCGGCCTGCCCGGGAC CGG Intronic
900674837 1:3878690-3878712 CAGCGAGGCCGGCCCGGGAGAGG - Intronic
901489206 1:9588236-9588258 CACCGCGCCCTGCCTGGATCTGG + Intergenic
901500989 1:9652447-9652469 CAACGCGGGAGGCCCGGGACTGG - Intronic
902875597 1:19338980-19339002 CCCCGCGGCCTCCGTGGGACGGG + Exonic
903350014 1:22711490-22711512 CACCGCGGCCGGCCGGGGTGGGG + Intronic
903931642 1:26865467-26865489 CCCCGCGGCCGGCCCGGCCCAGG - Intergenic
904209757 1:28879231-28879253 CACCGTGCCCAGCCTGGGACTGG - Intergenic
904652217 1:32014121-32014143 CCCCTCCGCCTCCCCGGGACCGG - Exonic
905560895 1:38926546-38926568 CACCGCGCCCTGCCCGAGTCAGG - Exonic
906537304 1:46558604-46558626 CACCACGGCCTGCCTGGGCCAGG + Exonic
908593407 1:65657915-65657937 CACCGCGGCCTGTCAGGGGATGG + Intergenic
911468459 1:98284934-98284956 CACTGGGGCCTGTCCGGGGCTGG - Intergenic
912270089 1:108200084-108200106 CACCGCGGCCTGCCAGGACGCGG - Exonic
912864123 1:113241790-113241812 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
913450196 1:118987872-118987894 CACCGGGCCCGGCCCGGGAGAGG + Intronic
915517551 1:156421892-156421914 CTCCCCGGCCGGCCCGGGAAGGG - Intronic
915555253 1:156657597-156657619 CACCGCAGACCGCCCGGGAGCGG + Intronic
920082613 1:203386192-203386214 CACCGCGCCCGGCCAGGGAAAGG + Intergenic
921729571 1:218562311-218562333 CACCGCGCCCGGCCTGGGAAGGG - Intergenic
922189993 1:223309980-223310002 GACCACGGCGTGCCTGGGACTGG + Intronic
922931650 1:229394856-229394878 CACCGGGGCCTGTCCGGGGATGG + Intergenic
923248402 1:232156403-232156425 CACCGGGGCCTGCTGGGGAATGG + Intergenic
923802901 1:237227718-237227740 GACGGCGGCCTGCCCAGGGCGGG + Intronic
923840089 1:237661331-237661353 CACCGGGGCCTGTCAGGGAGTGG + Intronic
924370839 1:243348336-243348358 CACCGCGCCCGGCCTGGGGCGGG + Intronic
924446623 1:244138654-244138676 GACCGTGGGCTGCCCGGGCCTGG + Intergenic
1062847882 10:721830-721852 CACCGCGCCCGGCCCAGGACAGG + Intergenic
1064483946 10:15766169-15766191 CACCGCGCCCGGCCCCGGGCAGG + Intergenic
1064968406 10:21038367-21038389 CACCGAGGCCTGCCAGGGGCTGG - Intronic
1065483900 10:26218046-26218068 CACCGCGGCCGGTGCGGGTCCGG + Intronic
1065501953 10:26391805-26391827 CGCCTGGGCCTGCCCAGGACCGG - Intergenic
1066997386 10:42576842-42576864 CACGGCGCCCGGCCCTGGACTGG - Intronic
1069784807 10:70981210-70981232 CATCTCTGCCTGCCCGGGGCTGG + Intergenic
1072783995 10:98268245-98268267 CTCCGCGGCCAGCTCGGGGCTGG - Exonic
1072805017 10:98418712-98418734 CACCGTGGCCTGCCCTGCAGGGG + Intronic
1076027535 10:127128546-127128568 CACCGGGGCCTGCTGGGGAGTGG - Intronic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1076827069 10:132974465-132974487 CAACTCGCCCTGCGCGGGACAGG + Intergenic
1076827097 10:132974565-132974587 CAACGCGCCCTGCCCGGGAGAGG + Intergenic
1076986146 11:237090-237112 CACAGCGGGCTGCCCGGGCCCGG - Exonic
1077075838 11:701695-701717 CACCGCGCCCGGCCGGAGACAGG + Intronic
1077214671 11:1390398-1390420 CAGCGCGGCCTCCCCGGCCCCGG - Intronic
1077302940 11:1855504-1855526 CCCCTCAGACTGCCCGGGACGGG + Intronic
1079248345 11:18769690-18769712 CACCGCGCCCGGCCAGGGACTGG + Intronic
1084128772 11:67118454-67118476 CGCCGGGGCCTGCCCGGGAATGG + Intergenic
1084871459 11:72101350-72101372 CATAGCAGCCTGCCCGTGACTGG + Intronic
1085281507 11:75334041-75334063 CACCGCGCCCGGCCTGGGATGGG - Intronic
1086050335 11:82581637-82581659 CACCGGGGCCTGCCGGGGGGTGG + Intergenic
1087596690 11:100262774-100262796 CACTGGGGCCTGCCAGGGAGTGG + Intronic
1087672806 11:101127754-101127776 CACCGCCGCTTCCCCGGGTCTGG + Exonic
1087913673 11:103782329-103782351 CACCGCGCCCTGCCTGGATCTGG + Intergenic
1091652258 12:2319146-2319168 GACCCCTGCCTGCCCAGGACAGG - Intronic
1092783301 12:12006948-12006970 CACCGCGCCCTGCCCAGGCCCGG + Intergenic
1093011879 12:14115733-14115755 CACCGCGGCCTGTCAGGGGGTGG + Intergenic
1093835097 12:23819584-23819606 CACCACGGCCTGTCGGGGAGTGG - Intronic
1094437901 12:30441692-30441714 CACCGCGCCCTGCAGTGGACAGG - Intergenic
1094473200 12:30822528-30822550 CACCTCCGCCCGCCCGCGACGGG - Intergenic
1094795987 12:33973260-33973282 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1095098354 12:38159623-38159645 CTCCGCGACCCTCCCGGGACTGG - Intergenic
1095861102 12:46918816-46918838 CACAGAGGCCTGCCTTGGACAGG + Intergenic
1096694811 12:53341770-53341792 CACCTCGGCCAGCCTGAGACAGG - Intronic
1097361789 12:58666322-58666344 CACCGGGGCCTGTCAGGGATCGG + Intronic
1098529137 12:71520702-71520724 CACCGGGGCCTGTCGGGGAATGG + Intronic
1099511501 12:83544537-83544559 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
1099550478 12:84037752-84037774 CACCTGGGCCTGTCAGGGACTGG - Intergenic
1100399112 12:94212481-94212503 CACCGGGGCCTGCCGGGGGGTGG - Intronic
1100467029 12:94855449-94855471 CACTGTGCCCTGCCCAGGACAGG - Intergenic
1100797673 12:98199318-98199340 CACCAGGGCCTGCCAGGGGCTGG - Intergenic
1101557885 12:105827752-105827774 CACCACGGCCTGTCAGGGACTGG + Intergenic
1101628069 12:106465618-106465640 CACCGAGGCCTGCCTGGGGTGGG - Intronic
1102461113 12:113100102-113100124 TACAGCAGCCTGCCCTGGACTGG - Intronic
1104409222 12:128544062-128544084 CACCGTGGCCTGCCAGCGCCTGG + Exonic
1104891571 12:132142700-132142722 CTCAGCTGCCTGCCCGGGGCTGG + Intronic
1105465471 13:20635709-20635731 CACCGGGGCCTGTCGGGGAGTGG + Intronic
1105661175 13:22497022-22497044 CAGCGCGGCCTGGCAGGGAGAGG + Intergenic
1106478062 13:30114916-30114938 CCCCGCGACCTGCCCCGGCCGGG - Intergenic
1107184519 13:37503039-37503061 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1108673482 13:52715508-52715530 CACCGGGGCCTGTCAGGGAGTGG - Intronic
1110390551 13:74968491-74968513 CACCGGGGCCTGTCGGGGGCTGG - Intergenic
1110436153 13:75480939-75480961 CACCGCCGTCCTCCCGGGACGGG + Intronic
1110856519 13:80302977-80302999 CACCGCGCCCTGTCCGAGACGGG + Intergenic
1111557573 13:89901434-89901456 CACCGGGGCCTGTCGGGGAGTGG - Intergenic
1112438577 13:99408796-99408818 CACCGTGGCCTTACCGGGAAGGG - Intergenic
1113664418 13:112131485-112131507 CTCCAGGGCCTGCCTGGGACAGG + Intergenic
1116776189 14:49183643-49183665 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
1117501803 14:56359753-56359775 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
1118810072 14:69266802-69266824 CACTGAGGCCAGCCCAGGACAGG + Intronic
1120139430 14:80911928-80911950 CACCGTGCCCTGCCCGGGAGTGG - Intronic
1120568293 14:86086242-86086264 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1121050386 14:90816116-90816138 CGCCGCGGCCTCCGCGGGAACGG - Intronic
1121050426 14:90816293-90816315 CATCGCGGCCTGGCCGGGCCCGG + Exonic
1121127563 14:91417856-91417878 CCCCGCGCCCCGCCCGGGTCTGG + Intergenic
1122547629 14:102533010-102533032 CACCGCGCCCAGCCCAGAACAGG - Intergenic
1122666640 14:103334548-103334570 CAACGCTGCTCGCCCGGGACTGG - Exonic
1122887594 14:104717297-104717319 CAGCGCGCCCTGCCCGGGGGGGG - Intronic
1122974983 14:105167413-105167435 CACCGCGGCCTGCCCGGGACCGG + Intronic
1124648117 15:31454177-31454199 GACCCCGGCCTCCCCGGGCCCGG + Intergenic
1124696715 15:31870212-31870234 CGCCGCGCCCTGCCCGAGAGAGG + Intronic
1124922234 15:34038642-34038664 CGCCGGCGCCTGCGCGGGACGGG - Intronic
1125527096 15:40383348-40383370 CACTGCGGCCTGGCCGGGGATGG + Intronic
1126613238 15:50550767-50550789 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1126666047 15:51077301-51077323 CAGGGCGGCCTGCCGGGGCCTGG - Intronic
1128520229 15:68370289-68370311 CACCGGGGCTTGGCCGGGCCAGG - Intronic
1130040957 15:80404741-80404763 GACCGGCGCCTGCCCGGGACCGG - Intronic
1131838079 15:96409852-96409874 CCCCGCGGCCTCCCCAGGCCGGG - Intergenic
1132506351 16:311316-311338 CACCGCGCCCAGCCCGCAACAGG + Intronic
1132582956 16:693820-693842 CACTGGGCCCTGCCCGGGATGGG + Exonic
1135342216 16:21658769-21658791 CACCGCGCCCGGCCCATGACTGG + Intergenic
1136481877 16:30547153-30547175 CACCGCGCCCAGCCCAGGACAGG + Intronic
1136625551 16:31459773-31459795 AGCCGGGGCCTGCCTGGGACGGG - Exonic
1138917393 16:61483041-61483063 CACCGGGGCCTGTCGGGGAATGG + Intergenic
1139571812 16:67817566-67817588 CACCGCGCCCGGCCAAGGACTGG + Intronic
1139582428 16:67881333-67881355 CACGGCTGCCTGCCAAGGACTGG + Exonic
1139637079 16:68264385-68264407 CGCCACGGCCTGGCCGGTACGGG - Intergenic
1140460320 16:75134466-75134488 CACCGCGCCCAGCCCAGGCCTGG - Intergenic
1141718087 16:85738617-85738639 CACCGCGCCGGGCCCGGCACTGG + Intronic
1142018642 16:87766133-87766155 CACCGCGCCCAGCCCGGGGCCGG - Intergenic
1143735124 17:8906161-8906183 CACCGGGGCCTGTCGGGGATGGG - Intronic
1145828844 17:27898640-27898662 CACCGCGCCCAGCCAAGGACCGG - Intergenic
1147200753 17:38799710-38799732 GGCCGCTGCCTCCCCGGGACGGG - Exonic
1148972357 17:51494912-51494934 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1150273095 17:63879345-63879367 CACCGCGCCCTGCCTGAGGCTGG + Intronic
1150824825 17:68465218-68465240 CACCGCGCCCGGCCCCGGCCGGG + Intergenic
1151522512 17:74640530-74640552 CACCGCGCCCTGCCAGGGTGGGG - Intergenic
1152691620 17:81720709-81720731 CACCGCTGCCTGCCCTGCAGTGG + Exonic
1153474861 18:5488399-5488421 CACTGGGGCCTGTCGGGGACTGG + Intronic
1154204923 18:12328138-12328160 TTCCACGGCCTGCCGGGGACAGG + Intronic
1157318099 18:46610385-46610407 CACCGGGGCCTGTCGGGGGCTGG + Intronic
1157832324 18:50867824-50867846 CACCGCGCCCAGCCCTGGAGTGG + Intergenic
1158436911 18:57440472-57440494 CCCAGCGGCCTGCCCGGAGCTGG + Intronic
1159040650 18:63320309-63320331 CGCCGCGGCAGGCCCGGGAGTGG + Intergenic
1160248848 18:77183707-77183729 CACCGGGGCCTGTCCGGGGAGGG - Intergenic
1160580959 18:79884418-79884440 AACCCCGGCCTGGCAGGGACTGG + Intronic
1160665797 19:327613-327635 CATCGGGGCCTCCCCAGGACTGG - Intronic
1160794094 19:936076-936098 CACCGCGCCCGGCCCGTGATGGG + Intronic
1160905536 19:1450150-1450172 CAGCGCCGCCTGCCCAGGCCCGG + Intronic
1160936897 19:1600499-1600521 CACCGCGCCCGGCCGGGCACAGG + Intronic
1161932495 19:7350113-7350135 CACCACCGCCTGCCTGGGACTGG + Intronic
1162099848 19:8333222-8333244 CACTGCGCCCTGCAAGGGACAGG + Exonic
1162464315 19:10831186-10831208 CACAGGGGCCGGCCCTGGACCGG - Exonic
1162632049 19:11935863-11935885 CACCGGGGCCTGTCAGGGGCTGG - Intronic
1162772255 19:12956307-12956329 CACCGCCCCCGGCCTGGGACAGG + Intronic
1163555469 19:17989924-17989946 CACGGCTCCCTGCCAGGGACGGG + Intronic
1163720596 19:18896425-18896447 CACCGCGCCGTGCCCGTGACGGG + Intronic
1164276374 19:23722330-23722352 CACTGCGCCCTGCCTGAGACTGG + Intergenic
1164758962 19:30713747-30713769 CACCACGCCCTGCCCAGTACAGG - Intergenic
1165058635 19:33194454-33194476 CGCCGCGGCCGGCCTGGGCCCGG - Intronic
1165167721 19:33868942-33868964 CGACGCTGCCTGCCCGGGAGCGG + Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165983636 19:39747905-39747927 CACTGCGGCCTGTCGGGGAGTGG + Intergenic
1166245356 19:41522020-41522042 CACCGCGGCCGGCGCCGGGCCGG - Intergenic
1166747338 19:45147605-45147627 CACCTGGGGCTGCCAGGGACAGG - Intronic
1167532871 19:50029432-50029454 CACTGCGGCCAGCCCTGCACTGG + Intronic
1167683582 19:50941447-50941469 CACTGCGCCCTGCCTGGGGCTGG + Intergenic
1167925954 19:52821189-52821211 GAACGCAGCCTTCCCGGGACTGG + Intronic
1167930140 19:52857175-52857197 GAACGCAGCCTTCCCGGGACTGG + Intronic
1167960780 19:53102978-53103000 AGGCGCGGCCTCCCCGGGACTGG + Intronic
1167971891 19:53192927-53192949 AGGCGCGGCCTCCCCGGGACTGG + Intronic
1167991715 19:53366134-53366156 GAACTCGGCCTCCCCGGGACCGG - Intronic
1168003597 19:53468142-53468164 GGACGCGGCCTTCCCGGGACTGG - Intronic
925178458 2:1800867-1800889 CACCGTGGCCTGCTGGGGAGGGG + Intronic
926193122 2:10742883-10742905 CACCGCAGCTTGCCCGTGTCTGG + Intronic
926527434 2:13998749-13998771 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
926546599 2:14248565-14248587 CACCGGGGCCTGTCAGGGACTGG + Intergenic
927147074 2:20173286-20173308 CACAGAGGCCTGCCCAGGTCAGG - Intergenic
927156490 2:20224288-20224310 CAGCGCGGCCGGCGCGGGAGCGG - Intronic
927501170 2:23584270-23584292 CACCGCCGCCTGCCCCGGTATGG - Intronic
927531752 2:23811582-23811604 CACCGGGGCCTGTCCGGGGGTGG + Intronic
927965499 2:27265155-27265177 CCGCGCGGGCTGCCCGGGAAGGG - Intronic
929353551 2:40991161-40991183 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
930045108 2:47163947-47163969 CACCGCGCCCGGCCTGAGACGGG - Intronic
931385451 2:61794031-61794053 CACCGGGGCCTGTCCGGGGGTGG - Intergenic
931457715 2:62425075-62425097 CACCAGGACCTGCCCGGGAGAGG - Intergenic
932567801 2:72920508-72920530 CCCAGAGGCCTGGCCGGGACTGG - Intronic
932732989 2:74233540-74233562 CAACGCGGCCTGACCGAGGCTGG - Exonic
932773245 2:74513347-74513369 TACCGCGGCCTGCACCGGGCAGG + Intergenic
933557822 2:83852091-83852113 CACCGTGGCCTGTCAGGGAATGG + Intergenic
934783362 2:96986882-96986904 CACCGCGCCCTGCCCACGCCAGG - Intronic
937237983 2:120442147-120442169 CGCCGCGGCCTCCCTGGGGCCGG - Intergenic
939179603 2:138788744-138788766 CACTGGGGCCTGCCCGGGCTGGG - Intergenic
941430744 2:165411006-165411028 CACCGCGCCCGGCCCGGGTCTGG - Intergenic
941934424 2:170972058-170972080 CACCGCGCCTGGCCCGGAACAGG - Intergenic
942049293 2:172123857-172123879 CACCGGGGCCTGCTGGGGAGGGG - Intergenic
942681413 2:178480819-178480841 CACCGCGGCCGGCGCCGGGCCGG + Exonic
945097283 2:206231605-206231627 CACCGCGCCCGGCCCTGGTCAGG + Intergenic
945431707 2:209772184-209772206 CACCGCGGGCCGCCCTGGGCTGG + Intronic
946404093 2:219483619-219483641 CACCCAGGCCTCCCCGGGCCAGG - Exonic
946617710 2:221527584-221527606 CACCGGGGTCTGCCCGACACTGG + Intronic
948566469 2:238890320-238890342 CAGCCCGGCCTGCGCGGGGCAGG + Intronic
949027776 2:241774424-241774446 GACCACTGCCTGCCCGGGGCAGG + Intergenic
1169395558 20:5225862-5225884 CACCGGGGCCTGTCTGGGCCTGG - Intergenic
1169498813 20:6139658-6139680 CACCGGGGCCTGCTGGGGGCTGG - Intergenic
1169940602 20:10933295-10933317 CACTGGGGCCTGCCAGGGGCGGG + Intergenic
1170613854 20:17934061-17934083 CACCCCTGCCTGCCCCGGAGAGG - Intergenic
1172072210 20:32266258-32266280 CACCGCTCCCAGCCCGTGACTGG + Intergenic
1173658989 20:44720070-44720092 CACCGGGTCCTGCCCCGGGCTGG - Exonic
1173813581 20:45971266-45971288 CGCCGCGGCCGCCCCGGGGCAGG - Exonic
1175184826 20:57173146-57173168 CCCCGCAGCCTGCCCGGCCCAGG + Intronic
1175399652 20:58693094-58693116 CTCCGCGGGCCGCCCGGGCCTGG - Intronic
1176111351 20:63412175-63412197 CGCCGCGGCCTGTCTGGTACCGG - Intronic
1176888270 21:14282648-14282670 CACCGCGCCGGGCCCGAGACTGG - Intergenic
1178372636 21:32038831-32038853 CACCGGGGCCTGCCAGGGCATGG - Intronic
1179521711 21:41949973-41949995 CACCAGGGCCTGTCAGGGACTGG + Intronic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180756160 22:18163353-18163375 CACCGCGCCCAGCCTGGGAGAGG - Intronic
1180991878 22:19941869-19941891 CGCGACGGCCCGCCCGGGACTGG - Exonic
1181512984 22:23397103-23397125 CACCGCAGCCAGGCCGGGGCTGG + Intergenic
1181818991 22:25461001-25461023 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1183201418 22:36387763-36387785 CGCCGCCGCCTGCCCGGGGCGGG + Intronic
1183452910 22:37906398-37906420 CCCCGCGGCCCGCCCGGCTCCGG - Exonic
1183698469 22:39436676-39436698 CCCCGCCCCCTCCCCGGGACTGG + Intronic
1184155189 22:42662545-42662567 CACCCCGGCCCGCCCGGCCCGGG - Intergenic
1184280569 22:43435226-43435248 CACAGCCGCCCGCCCGGGGCAGG - Intronic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
1185306972 22:50124591-50124613 CACAGCAGCCTGCCCGGAATTGG - Intronic
950815739 3:15700282-15700304 CACCGGGGCCTGTCCGGGGTGGG + Intronic
951174669 3:19585132-19585154 CACCGGGGCCTGCTGTGGACTGG + Intergenic
951558792 3:23945798-23945820 CAGCGCGGCCTGCCGGCGCCCGG + Intronic
953013782 3:39052856-39052878 CACCGGGGCCTGTCGGGGGCTGG + Intronic
954836745 3:53476405-53476427 TACCGGGGCCTGCCAGGGAGTGG - Intergenic
956460370 3:69465546-69465568 CACCGGGGCCTGTCGGGGGCTGG - Intronic
959349198 3:105239300-105239322 CACCGGGGCCTGTCGGGGATGGG - Intergenic
961351644 3:126308060-126308082 CGCCGTGGCCTGGCTGGGACGGG + Intergenic
961501387 3:127338305-127338327 CACCTCTGCCTGCCCCAGACCGG - Intergenic
962284613 3:134075593-134075615 CACGGCGGCCTTCCCAGGCCAGG + Intronic
962662913 3:137622606-137622628 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
963925984 3:150951624-150951646 CACCGCGCCCGGCCTGAGACTGG + Intronic
965770600 3:172177856-172177878 CACTGGGGCCTGTCAGGGACAGG - Intronic
967157838 3:186709917-186709939 CACCGCGCCCGGCCCGGGAATGG - Intergenic
968163211 3:196443913-196443935 CACCACGCCCGGCCTGGGACGGG + Intergenic
968514858 4:1011734-1011756 CCCCGCCGCCTGCCCGGTCCGGG + Intronic
968556140 4:1247446-1247468 CTCCCCTGCCTGCCCGGGCCTGG - Intronic
968556821 4:1249740-1249762 GACCGCGTCCTGCCCGGCCCGGG + Intronic
968674957 4:1872002-1872024 CACCGCGGCCGCCCCGGACCGGG - Intronic
968727244 4:2253435-2253457 CTCTGCGGCCTGCACGGGATGGG - Intronic
969273214 4:6116874-6116896 CCCCACCGCCTGCCCGTGACAGG - Intronic
969455843 4:7299168-7299190 CAGGGCGGCCTGTCCGGGGCTGG + Intronic
969833774 4:9821482-9821504 CACCGGGGCCTGTCAGGGGCTGG + Intronic
970075614 4:12216214-12216236 CACCGGGGCCTGCCAGGGGGAGG + Intergenic
970512956 4:16799139-16799161 CACCGCGCCCGGCTCGTGACTGG + Intronic
970586881 4:17522988-17523010 GACCGCTGACTGCCCGGTACGGG - Exonic
970651110 4:18179080-18179102 CACCGGGGCCTGTCCGGGGCTGG + Intergenic
971769369 4:30876911-30876933 CACCGGGGCCTGTCTGGGAGTGG - Intronic
971993658 4:33935029-33935051 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
972516606 4:39815465-39815487 CACCGCGCCCAGCCCGAAACTGG + Intergenic
976595667 4:86892540-86892562 GAGCGCGGCCTGCCCCGGCCCGG - Intronic
976938352 4:90667498-90667520 CACCGGGGCCTGTCAGGGAGTGG - Intronic
977002497 4:91521040-91521062 CACCGGGGCCTGTCAGGGGCGGG - Intronic
980572405 4:134637742-134637764 CACCGCGCCCGGCCCTGGATAGG + Intergenic
982988595 4:162242607-162242629 CACCGCGCCCGGCCTGTGACTGG - Intergenic
983517188 4:168670443-168670465 CACCGCGCCCGGCCCGCGCCCGG - Intronic
984126943 4:175822833-175822855 CACCGGGGCCTGCCAGAGGCTGG - Intronic
986304650 5:6506318-6506340 CACTGAGGCCTGCCAGGGAGGGG + Intergenic
987758290 5:22125266-22125288 CACCGAGGCCTGTCGGGGAGTGG - Intronic
987852383 5:23373214-23373236 CACCGGGGCCTGTCGGGGAGTGG - Intergenic
988667174 5:33341841-33341863 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
990049683 5:51482298-51482320 CACCGGGGCCTGTCCGGGCATGG + Intergenic
990618352 5:57531042-57531064 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
995156412 5:108918773-108918795 CACCGCGCCCCGCCTTGGACTGG + Intronic
997342343 5:133154469-133154491 CACCGCGCCCGGCCTGGGAGAGG - Intergenic
997529128 5:134571408-134571430 CACCGCGCCCGGCCCAGGGCTGG - Intronic
998165088 5:139838257-139838279 CCCCGCTGCCTGCCCAGCACTGG - Intronic
1001506453 5:172283948-172283970 CGCTGCGGCCCGCCCGGGATGGG - Exonic
1002887749 6:1311735-1311757 CCTCGCGGGCTGCCCGGGGCTGG + Intergenic
1003559282 6:7167617-7167639 CACCGCTCCCGGCCGGGGACAGG + Intronic
1003872310 6:10412784-10412806 CCCGGCGCCCTGCCCGGGACCGG + Intronic
1004842044 6:19598569-19598591 CACCGCGCCCGGCCCAGGCCGGG + Intergenic
1005581154 6:27236358-27236380 CACCGCGTCCGGCCCAGAACTGG + Intergenic
1006671755 6:35733786-35733808 CACCGCGCCCAGCCCTGAACTGG + Intergenic
1006916626 6:37598697-37598719 CACCGGGGCCTGTCAGGGAATGG - Intergenic
1007076911 6:39074093-39074115 GCCCTCGGGCTGCCCGGGACTGG - Intronic
1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG + Intronic
1007519431 6:42440054-42440076 CACCGTGGCCTGGCAGGGATGGG + Intronic
1012401208 6:98843875-98843897 CCCCGCGGCCAGCCCGGGCGGGG + Intergenic
1014211462 6:118712660-118712682 CACCGCGCCCAGCCCAGGAAAGG + Intergenic
1014902815 6:126988490-126988512 CACTGGGGCCTGTCCGGGAGTGG + Intergenic
1017285778 6:152674771-152674793 CACTGGGGCCTGTCGGGGACTGG - Intergenic
1017297761 6:152818423-152818445 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1017713435 6:157190395-157190417 CACTGAGGCCAGCCGGGGACAGG - Intronic
1019189321 6:170241962-170241984 CACCGCGCCCGGCCTGAGACCGG - Intergenic
1019702381 7:2480237-2480259 CACCGCGGCCTGACAGGGCGAGG - Intergenic
1019716268 7:2540886-2540908 CGCAGAGGCCTGCACGGGACGGG + Intronic
1020278324 7:6637558-6637580 CCCCGCGGCCTCCCCGCGCCGGG - Intronic
1021171684 7:17405081-17405103 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
1024236739 7:47404596-47404618 CACCGCGCCCGGCCGGGCACAGG - Intronic
1027849449 7:83430663-83430685 CACCGGGGCCTGTCAGGGGCTGG + Intronic
1029250819 7:99234885-99234907 CACCGCGCCCGGCCAGGCACTGG + Intergenic
1029543777 7:101199803-101199825 CACCGCGCCCGGCCTGGGAGTGG - Intronic
1030464984 7:109889783-109889805 CACCGAGGCCTGTCAGGGAGTGG + Intergenic
1032717306 7:134520607-134520629 CACCGGGGCCTGCTGGGGGCTGG + Intergenic
1034469849 7:151249219-151249241 CACCGCCGCCGGCCCCGGGCAGG - Intronic
1034869949 7:154675192-154675214 CACCGGGGCCTGTCCGGGGGCGG + Intronic
1035315859 7:157997361-157997383 CTCCGTGGCCTTCCCAGGACAGG - Intronic
1036221168 8:6922765-6922787 CACAGCGGCCTGCAAGGGCCAGG - Intergenic
1036406161 8:8456926-8456948 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1037817351 8:22119174-22119196 CACCACTGCCTGCCTGGCACCGG - Exonic
1037995873 8:23352100-23352122 CACCGTGCCCAGCCCTGGACAGG + Intronic
1040422041 8:47250004-47250026 CACCGCGCCCGGCCGAGGACAGG - Intergenic
1041490106 8:58423721-58423743 CACCGCGCCCAGCCGGGGATGGG + Intronic
1041512937 8:58671518-58671540 CACCGTGCCCTGCCTGGGTCTGG - Intergenic
1042349520 8:67762775-67762797 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1043828836 8:84963237-84963259 CACTGGGGCCTGTCGGGGACTGG + Intergenic
1045102347 8:98858131-98858153 CACCTCGGCCTCCCAAGGACTGG - Intronic
1045483853 8:102614629-102614651 CACCGGGGCCTGTCCGGGGGTGG + Intergenic
1045965665 8:108021755-108021777 CACCGGGGCCTGTCGGGGGCAGG + Intronic
1046865871 8:119149780-119149802 CACCGTGCCCGGCCCGAGACTGG - Intergenic
1048594724 8:135854377-135854399 CACCGGGGCCTGTCGGGGAGTGG - Intergenic
1048910906 8:139134096-139134118 CACCGCGGCCTGTCGGGGCATGG - Intergenic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049090427 8:140510478-140510500 CTCCGCGGCCTTCCCTGGTCTGG + Intergenic
1049762213 8:144336716-144336738 CACCGCGGCCAGCGCCGGCCTGG + Intergenic
1050231131 9:3526558-3526580 CTCCGCGGCCTGCGCTAGACTGG + Intergenic
1051272175 9:15366168-15366190 CACAGGGGCCTGTCGGGGACTGG - Intergenic
1052290773 9:26837589-26837611 CACCGGGGCCTGTCGGGGAGTGG + Intergenic
1053129059 9:35605243-35605265 CTCCGCGGCCTGCCGGGGGCGGG - Intergenic
1055486454 9:76760801-76760823 CACCGCGCCCGGCCCGAGTCTGG - Intronic
1058063573 9:100524896-100524918 CACCGGGGCCTGCCAGGGGTGGG - Intronic
1059698203 9:116748743-116748765 CACCCAGTCCTGCCCTGGACAGG + Intronic
1060728296 9:126020852-126020874 CACCGCGCCCTGCAGGGGACTGG + Intergenic
1060835923 9:126755139-126755161 CACTGCGGCCCGCCAGGGCCCGG - Intergenic
1061746674 9:132745302-132745324 AACCGCGGGCTGCCCAGGGCCGG + Intronic
1061851348 9:133417883-133417905 GACCCCGGCCTCCCCGGGCCCGG + Exonic
1061921607 9:133785526-133785548 CAGCGGAGCCTGCCTGGGACAGG + Intronic
1061991755 9:134163221-134163243 CACCGCGTCCTTCCCCGGAGGGG + Intergenic
1062001757 9:134219452-134219474 CTCCTCGTCCTGCCAGGGACTGG - Intergenic
1062022612 9:134326547-134326569 CGGCGCGGCCGGCCCGGGCCCGG - Intronic
1185552390 X:993465-993487 CACCGCGCCCAGCCCGAGACTGG - Intergenic
1185655593 X:1682513-1682535 CACCGGGGCCTGTCAGGGGCTGG - Intergenic
1185947544 X:4394664-4394686 CACCGCGGCCTGTCAGGGGTTGG - Intergenic
1186929689 X:14375060-14375082 CACCGGGGCCTGTCAGGGGCTGG + Intergenic
1186950709 X:14621519-14621541 CACCGGGGCCTGTCGGGGGCTGG - Intronic
1188178294 X:27021941-27021963 CACCGGGGCCTGTCAGGGAGTGG - Intergenic
1188896910 X:35680185-35680207 CACCGGGGCCTGCCGGGGGTTGG - Intergenic
1190776111 X:53553428-53553450 CACCGCGCCCAGCCCGGGTAAGG + Intronic
1191738261 X:64410108-64410130 CACCGGGGCCTGTCGGGGGCTGG + Intergenic
1191777090 X:64826497-64826519 CATTGGGGCCTGCCAGGGACTGG + Intergenic
1192889517 X:75374216-75374238 CACCGGGGCCTGTCGGGGGCTGG + Intronic
1196965113 X:121047430-121047452 CGCCGCGGCCTCGCCGGGCCTGG - Intergenic