ID: 1122975366

View in Genome Browser
Species Human (GRCh38)
Location 14:105168667-105168689
Sequence CGTCGCCGCCGGGTGGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 148}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975366_1122975378 6 Left 1122975366 14:105168667-105168689 CCGGCTCCCACCCGGCGGCGACG 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1122975378 14:105168696-105168718 GCGGTGAAGGCAGCGGGTCCCGG 0: 1
1: 0
2: 2
3: 46
4: 638
1122975366_1122975379 12 Left 1122975366 14:105168667-105168689 CCGGCTCCCACCCGGCGGCGACG 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1122975379 14:105168702-105168724 AAGGCAGCGGGTCCCGGCCTCGG 0: 1
1: 0
2: 0
3: 11
4: 225
1122975366_1122975375 -7 Left 1122975366 14:105168667-105168689 CCGGCTCCCACCCGGCGGCGACG 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1122975375 14:105168683-105168705 GGCGACGGCGGCGGCGGTGAAGG 0: 1
1: 3
2: 103
3: 1468
4: 2656
1122975366_1122975377 0 Left 1122975366 14:105168667-105168689 CCGGCTCCCACCCGGCGGCGACG 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1122975377 14:105168690-105168712 GCGGCGGCGGTGAAGGCAGCGGG 0: 1
1: 0
2: 7
3: 81
4: 639
1122975366_1122975376 -1 Left 1122975366 14:105168667-105168689 CCGGCTCCCACCCGGCGGCGACG 0: 1
1: 0
2: 1
3: 6
4: 148
Right 1122975376 14:105168689-105168711 GGCGGCGGCGGTGAAGGCAGCGG 0: 1
1: 0
2: 24
3: 332
4: 2305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975366 Original CRISPR CGTCGCCGCCGGGTGGGAGC CGG (reversed) Exonic
900371837 1:2335690-2335712 CCTGGCAGGCGGGTGGGAGCGGG + Intronic
901109607 1:6784845-6784867 CGCCGCTGCCGGTGGGGAGCCGG - Intergenic
901641119 1:10693763-10693785 CGGCGGGGCCGGGTGGGGGCCGG - Intronic
901797940 1:11691492-11691514 CGCCGCCGCCGCGAGGGCGCGGG - Exonic
903492903 1:23743306-23743328 CGCGGCCGCCGGGTGGGCGCTGG + Exonic
903597105 1:24503085-24503107 CGCCGCCGCAGGACGGGAGCCGG - Exonic
903628113 1:24745663-24745685 CCCCGCAGCCGGGAGGGAGCCGG - Intronic
904044481 1:27601851-27601873 TGTCGCCGCCGGCTGGGCGGGGG - Intronic
910182983 1:84505953-84505975 CGGCGGCGGCGGGTGGGATCCGG - Intronic
915724518 1:158008137-158008159 CCTCGCTGCCGGCTAGGAGCAGG - Intronic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
921355564 1:214281443-214281465 CGGCGGCGGCGGGCGGGAGCCGG + Intronic
1062890553 10:1056718-1056740 CGGCGCCGCCGGGTGTGGGGCGG + Intronic
1063357263 10:5412791-5412813 CGACACCTCCGGGTCGGAGCTGG + Exonic
1063504013 10:6580170-6580192 CGCCGCCGCCGGGAGGGAGCGGG - Intronic
1067300229 10:45001116-45001138 CCTGGCCGCCGGGCGGGGGCGGG + Intronic
1074881008 10:117658788-117658810 CGTTGCCTCTGGGTGGGGGCTGG - Intergenic
1075743451 10:124710060-124710082 CGTGGCCGCCGGGTCGGACTTGG + Intronic
1076948727 10:133667510-133667532 CATCGCCGCCCGGGAGGAGCTGG + Exonic
1076949711 10:133670809-133670831 CATCGCCGCCCGGGAGGAGCTGG + Intronic
1076950695 10:133674108-133674130 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076951685 10:133677418-133677440 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076952674 10:133680728-133680750 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076953658 10:133684027-133684049 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076955631 10:133743689-133743711 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076956621 10:133746999-133747021 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076957608 10:133750308-133750330 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076958593 10:133753607-133753629 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076959582 10:133756917-133756939 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1076960566 10:133760216-133760238 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
1083922055 11:65786559-65786581 CGAAGCCGCCGGGCGGGAACGGG - Intergenic
1085017555 11:73185378-73185400 TGTCGCCTCCGTGTGGCAGCAGG - Intergenic
1090978391 11:131695037-131695059 CGCCGCCGCCGGGAGGGTGCAGG + Intronic
1092046198 12:5433119-5433141 GGTGGCCACCGGGTGGGCGCTGG - Intronic
1092230635 12:6773735-6773757 GGGCGCCGCCGGGTGAGGGCCGG - Exonic
1092502655 12:9064548-9064570 CGCCGCCGCGGAGTGGGAGTGGG + Intergenic
1095465513 12:42484104-42484126 CGCCGCCCGCGGGCGGGAGCGGG - Intronic
1096148632 12:49295381-49295403 CGTAGCCCCCGAGCGGGAGCGGG + Exonic
1100329679 12:93571636-93571658 CGTCGCCGCGCGGTGGGGGATGG + Intronic
1103400671 12:120640990-120641012 CGGCGTCGCCGGGCAGGAGCCGG - Exonic
1103954290 12:124567697-124567719 CGTCGCTGCGGGCGGGGAGCCGG - Intergenic
1104897681 12:132172335-132172357 CTCAGCCGCCGGGTGGGAGGTGG - Intergenic
1105767991 13:23579592-23579614 GATCCCCGCTGGGTGGGAGCCGG + Intronic
1108510173 13:51148680-51148702 CGTCGCTGCCCAGTGGGAGTGGG - Intergenic
1112504543 13:99968335-99968357 CGCGGCCGCCGGGAGGGGGCAGG + Intronic
1113541769 13:111115139-111115161 CGGCGGCGGCGGCTGGGAGCGGG - Intronic
1114069700 14:19097472-19097494 GGTGGGCGTCGGGTGGGAGCCGG - Intergenic
1116950196 14:50872240-50872262 CGTGGCCGCCTGGTGGGACATGG + Exonic
1122906091 14:104802172-104802194 CCACGCCGTCGGGTGAGAGCCGG - Exonic
1122917323 14:104865189-104865211 CGGCGCGGCCGGGCGGGGGCGGG + Intergenic
1122975366 14:105168667-105168689 CGTCGCCGCCGGGTGGGAGCCGG - Exonic
1125532353 15:40421926-40421948 CCTGCCTGCCGGGTGGGAGCTGG + Intronic
1125541325 15:40471429-40471451 CCTCGCGGCCGGGCGGGTGCAGG - Exonic
1126823650 15:52528891-52528913 CGCAGCCGCCGGCAGGGAGCAGG + Exonic
1132512787 16:352569-352591 CGGAGCGGGCGGGTGGGAGCTGG - Exonic
1132855063 16:2041049-2041071 CGGGGCCACCGGGTGGGAGAAGG - Intronic
1135976105 16:27109822-27109844 CATCGCCGCTGGGGGGCAGCAGG - Intergenic
1139528155 16:67528989-67529011 CGGCGCCGCCCGGTGGGTCCGGG + Intronic
1141531124 16:84648098-84648120 CCTCGCCGCAGGGTGGCCGCAGG + Intergenic
1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG + Intergenic
1142750378 17:1983924-1983946 TGTCCCAGCCGGGAGGGAGCAGG - Intronic
1143141988 17:4745925-4745947 CGGCGCCTTCGGGTGGGGGCAGG - Exonic
1143411522 17:6712411-6712433 CTTGGCCGCAGGGTGGGCGCAGG - Intronic
1145210688 17:21011120-21011142 CGCCCCCGCCGTGTGGGTGCAGG + Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146057640 17:29589266-29589288 GGCCGCCGCCGGGCGGGCGCCGG - Intronic
1147316314 17:39622072-39622094 TGGCGCCCCCAGGTGGGAGCTGG - Intergenic
1148607993 17:48944709-48944731 CACCGCCGCGGGGTGGGAGCTGG - Exonic
1152593894 17:81229049-81229071 TGTCCCCGCCTGGTGGGGGCTGG - Exonic
1152617974 17:81346428-81346450 CGTCGCCGGCGGGTGCGCCCAGG + Intergenic
1154125636 18:11689716-11689738 CTTCGCCGCCCCGAGGGAGCAGG - Exonic
1156325025 18:36067266-36067288 CATCGTCACCGTGTGGGAGCGGG - Exonic
1158137583 18:54224181-54224203 CGGCGCCCCCCGGCGGGAGCCGG - Exonic
1160672913 19:374694-374716 CAGCCCCGCCAGGTGGGAGCTGG - Intronic
1160717863 19:584547-584569 CAGCGCCGCCTGGTGGCAGCCGG - Intergenic
1161683166 19:5690589-5690611 CGACGCCGCGGGGTGAGTGCGGG + Exonic
1162145594 19:8610911-8610933 CGCCCCCGCCGCGTGGGAGGGGG + Intergenic
1162683770 19:12365363-12365385 CTCGGCCGCGGGGTGGGAGCTGG - Intronic
1164746696 19:30621689-30621711 AGGAGCAGCCGGGTGGGAGCCGG + Intronic
1167268190 19:48493642-48493664 GGTCGCGGCCTGGAGGGAGCAGG - Intronic
1168339064 19:55613599-55613621 CATCTCCGGCGGGTGGGAGACGG - Exonic
926098352 2:10097425-10097447 AGGGGCCGCCGGGTGGGGGCTGG - Intergenic
927141659 2:20135171-20135193 CATGGCCCCAGGGTGGGAGCTGG - Intergenic
936938303 2:117859037-117859059 CGACGCCGCTGGGTGGGGGAGGG + Intergenic
938058334 2:128233385-128233407 CGTCGCCGCCGGGAGAGCGAAGG - Intergenic
942151064 2:173076156-173076178 CGCCGCCGCCGGGCGGGCCCTGG - Intronic
942218986 2:173750692-173750714 CGTGGCTGCAGGCTGGGAGCAGG - Intergenic
943669792 2:190648857-190648879 GGCCGCCGCCGGGCGGGGGCGGG - Intronic
947353600 2:229271170-229271192 CACCGCCGCCGGGTGGGCGTAGG + Exonic
1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG + Intergenic
1172951100 20:38724072-38724094 CGCCGCCGCAGGGTGGGAGGGGG - Intergenic
1175968477 20:62671900-62671922 CGCCGTGGCCGGGTGGGCGCGGG - Exonic
1176306100 21:5123909-5123931 GGACGCCACCGTGTGGGAGCCGG + Intronic
1179879067 21:44285993-44286015 CGTCGCCATGGGGTGGGCGCGGG - Exonic
1180949214 22:19713780-19713802 CTTCTCCGCAGGGTGGGATCGGG + Intergenic
1181283464 22:21735959-21735981 CGTCCCGGCCGGGTGCGAGCTGG - Intergenic
1183358438 22:37371474-37371496 CTTCACCTCTGGGTGGGAGCTGG - Exonic
1183437151 22:37802766-37802788 CCTCGCCGCCTGGCGGGAGAAGG + Intergenic
1184680887 22:46071609-46071631 CTTCGCCGCCGGATCGGAGCGGG - Intronic
1185395206 22:50583173-50583195 CGTCTCTGCCCCGTGGGAGCCGG + Intronic
952764885 3:36945098-36945120 CGTCGCTGCTGAGTGGGAGGAGG + Intergenic
953908790 3:46881834-46881856 CGTCGCGGCCGGGGGCGCGCGGG + Intronic
954063583 3:48088774-48088796 CGCCGCCGCCGAGACGGAGCTGG + Exonic
955182278 3:56683265-56683287 CGTCGGGGCCGGGAGGGGGCGGG + Intergenic
957028641 3:75214601-75214623 CGTCGCCGCCGGGGGGAGGAGGG + Intergenic
962520748 3:136195853-136195875 CGCCGCCGGCGGGCGGGAGGGGG + Intronic
967982165 3:195072183-195072205 TGTCGACACCGGGTGGAAGCAGG + Intronic
969115741 4:4869690-4869712 CGTGGCACCCGGGTGGCAGCAGG + Intergenic
974047275 4:56908360-56908382 CGGCCCCGCCGGGCGGGGGCTGG + Intronic
985446191 4:190022284-190022306 CATCGCCGCCCGGGAGGAGCTGG - Intergenic
985452181 4:190068294-190068316 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985453165 4:190071591-190071613 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985454155 4:190074884-190074906 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985455143 4:190078177-190078199 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985456131 4:190081477-190081499 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985457115 4:190084771-190084793 CATCGCCGCCCGGGAGGAGCTGG + Intergenic
985458102 4:190088064-190088086 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985459091 4:190091364-190091386 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985463344 4:190174133-190174155 CATCGCCGCCCGGGAGGAGCTGG + Exonic
985696717 5:1345027-1345049 CCGCGGCGCCAGGTGGGAGCGGG - Exonic
989229985 5:39074473-39074495 CGTCGCCGCCGAGGGGGCGGGGG - Intergenic
990557748 5:56952199-56952221 CTCCGCCGCCGGGCGGGTGCCGG - Intronic
1007558105 6:42783143-42783165 CGCCGCCGCGGGCTCGGAGCGGG - Intronic
1007558245 6:42783674-42783696 CGAGGCCGCCGGCTCGGAGCGGG + Intronic
1008649065 6:53544942-53544964 CGCCGCCGCCGCATCGGAGCGGG - Exonic
1011272623 6:85594303-85594325 ACTCGGCTCCGGGTGGGAGCAGG + Intronic
1017672476 6:156779493-156779515 CGAGGCCGCCGGGCGGAAGCAGG - Intronic
1017692185 6:156977963-156977985 CCTCTCTGGCGGGTGGGAGCAGG + Intronic
1017786591 6:157761982-157762004 CGTCGCAGCAGGAAGGGAGCCGG + Intronic
1019577991 7:1746719-1746741 TGGCTCGGCCGGGTGGGAGCCGG - Exonic
1020643153 7:10780280-10780302 CGTCGCCGCCTGTTAGGAGAAGG + Intergenic
1021991901 7:26148275-26148297 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991924 7:26148322-26148344 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1021991947 7:26148369-26148391 CGCCCCCTCCGGGAGGGAGCTGG + Intergenic
1023067154 7:36389675-36389697 CCTCGCCGCGGGGTGGAGGCGGG - Intronic
1027111462 7:75442950-75442972 GATCGCCTCCGGATGGGAGCCGG - Intronic
1027283692 7:76627483-76627505 GATCGCCTCCGGATGGGAGCCGG - Intergenic
1030033473 7:105388992-105389014 CGGGGCCGGCGGGTGGGGGCGGG - Intronic
1039949051 8:42153415-42153437 CGTCGCCGCCGGCTCTGGGCCGG + Intronic
1040080347 8:43277288-43277310 CGGCGCCGCCACCTGGGAGCCGG + Intergenic
1041045194 8:53881204-53881226 CGTTGCTGCGGGGCGGGAGCCGG + Intronic
1041689889 8:60678665-60678687 CGGCGCGGCCCGGAGGGAGCTGG + Intergenic
1049372123 8:142272897-142272919 CCTCGCAGGCAGGTGGGAGCAGG + Intronic
1049708144 8:144052122-144052144 GGGCACGGCCGGGTGGGAGCCGG - Intronic
1053142607 9:35690742-35690764 GGACGCGTCCGGGTGGGAGCGGG - Exonic
1055090987 9:72364796-72364818 CGCCGCCGCGGGCCGGGAGCGGG + Intronic
1057463762 9:95292393-95292415 CGTGGCCGCCGGGACGGCGCGGG - Intronic
1060549372 9:124477810-124477832 CGGCGCCCGCGGGTGGGGGCGGG - Intronic
1061208545 9:129177761-129177783 CGCCGCCGCCAAGTTGGAGCGGG + Exonic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1203773375 EBV:60356-60378 CGCCGCCGCCAGGTGGGCCCTGG - Intergenic
1187507267 X:19887755-19887777 CGCGGCCGCCGGGCGGGGGCGGG + Intergenic
1194977882 X:100411240-100411262 GGTCGCCGACAGCTGGGAGCCGG + Intergenic
1200100655 X:153687995-153688017 CGCCGCCGCCGGGAAGGAGAGGG + Intronic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic
1201178064 Y:11321917-11321939 CATCGCCGCCAGGTAAGAGCTGG + Intergenic