ID: 1122975429

View in Genome Browser
Species Human (GRCh38)
Location 14:105168873-105168895
Sequence TCCACCGCCTTTAAAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975429_1122975442 22 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 216
1122975429_1122975434 1 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1122975429_1122975435 6 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975435 14:105168902-105168924 CGCCTGCCAGCGCCCCGGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 346
1122975429_1122975441 21 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975441 14:105168917-105168939 CGGCCCGGCGCGCGCCCCCCAGG 0: 1
1: 0
2: 3
3: 45
4: 432
1122975429_1122975445 29 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284
1122975429_1122975446 30 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975429 Original CRISPR TCCACCGCCTTTAAAGCCTG GGG (reversed) Intergenic