ID: 1122975431

View in Genome Browser
Species Human (GRCh38)
Location 14:105168875-105168897
Sequence CCTCCACCGCCTTTAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975431_1122975442 20 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 216
1122975431_1122975446 28 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1122975431_1122975441 19 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975441 14:105168917-105168939 CGGCCCGGCGCGCGCCCCCCAGG 0: 1
1: 0
2: 3
3: 45
4: 432
1122975431_1122975445 27 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284
1122975431_1122975434 -1 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1122975431_1122975435 4 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975435 14:105168902-105168924 CGCCTGCCAGCGCCCCGGCCCGG 0: 1
1: 0
2: 2
3: 31
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975431 Original CRISPR CCTCCACCGCCTTTAAAGCC TGG (reversed) Intergenic