ID: 1122975434

View in Genome Browser
Species Human (GRCh38)
Location 14:105168897-105168919
Sequence GGCGTCGCCTGCCAGCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975431_1122975434 -1 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1122975429_1122975434 1 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1122975430_1122975434 0 Left 1122975430 14:105168874-105168896 CCCAGGCTTTAAAGGCGGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1122975423_1122975434 22 Left 1122975423 14:105168852-105168874 CCGGGGGGGGGTCCGGGGGCGCC 0: 1
1: 0
2: 4
3: 36
4: 350
Right 1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 144
1122975425_1122975434 10 Left 1122975425 14:105168864-105168886 CCGGGGGCGCCCCAGGCTTTAAA 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1122975434 14:105168897-105168919 GGCGTCGCCTGCCAGCGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975434 Original CRISPR GGCGTCGCCTGCCAGCGCCC CGG Intergenic