ID: 1122975436

View in Genome Browser
Species Human (GRCh38)
Location 14:105168904-105168926
Sequence CGCCGGGCCGGGGCGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 2, 2: 6, 3: 57, 4: 546}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975436_1122975459 15 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975459 14:105168942-105168964 GCCCGGGCGGCGGGGGCACGGGG 0: 1
1: 0
2: 6
3: 75
4: 549
1122975436_1122975462 21 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975462 14:105168948-105168970 GCGGCGGGGGCACGGGGCCTCGG 0: 1
1: 0
2: 7
3: 55
4: 511
1122975436_1122975454 7 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975454 14:105168934-105168956 CCCAGGGCGCCCGGGCGGCGGGG 0: 1
1: 1
2: 31
3: 47
4: 412
1122975436_1122975458 14 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975458 14:105168941-105168963 CGCCCGGGCGGCGGGGGCACGGG 0: 1
1: 0
2: 3
3: 45
4: 413
1122975436_1122975442 -9 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 216
1122975436_1122975447 2 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975447 14:105168929-105168951 CGCCCCCCAGGGCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 216
1122975436_1122975463 22 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975463 14:105168949-105168971 CGGCGGGGGCACGGGGCCTCGGG 0: 1
1: 0
2: 3
3: 24
4: 291
1122975436_1122975446 -1 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1122975436_1122975464 23 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975464 14:105168950-105168972 GGCGGGGGCACGGGGCCTCGGGG 0: 1
1: 0
2: 3
3: 41
4: 411
1122975436_1122975441 -10 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975441 14:105168917-105168939 CGGCCCGGCGCGCGCCCCCCAGG 0: 1
1: 0
2: 3
3: 45
4: 432
1122975436_1122975450 5 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975450 14:105168932-105168954 CCCCCAGGGCGCCCGGGCGGCGG 0: 1
1: 0
2: 2
3: 31
4: 340
1122975436_1122975452 6 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975452 14:105168933-105168955 CCCCAGGGCGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 35
4: 383
1122975436_1122975457 13 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975457 14:105168940-105168962 GCGCCCGGGCGGCGGGGGCACGG 0: 1
1: 1
2: 15
3: 66
4: 572
1122975436_1122975456 8 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975456 14:105168935-105168957 CCAGGGCGCCCGGGCGGCGGGGG 0: 1
1: 2
2: 4
3: 98
4: 610
1122975436_1122975445 -2 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975436 Original CRISPR CGCCGGGCCGGGGCGCTGGC AGG (reversed) Intergenic