ID: 1122975437

View in Genome Browser
Species Human (GRCh38)
Location 14:105168908-105168930
Sequence CGCGCGCCGGGCCGGGGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 869
Summary {0: 2, 1: 0, 2: 14, 3: 88, 4: 765}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975437_1122975463 18 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975463 14:105168949-105168971 CGGCGGGGGCACGGGGCCTCGGG 0: 1
1: 0
2: 3
3: 24
4: 291
1122975437_1122975445 -6 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284
1122975437_1122975452 2 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975452 14:105168933-105168955 CCCCAGGGCGCCCGGGCGGCGGG 0: 1
1: 0
2: 0
3: 35
4: 383
1122975437_1122975464 19 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975464 14:105168950-105168972 GGCGGGGGCACGGGGCCTCGGGG 0: 1
1: 0
2: 3
3: 41
4: 411
1122975437_1122975458 10 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975458 14:105168941-105168963 CGCCCGGGCGGCGGGGGCACGGG 0: 1
1: 0
2: 3
3: 45
4: 413
1122975437_1122975462 17 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975462 14:105168948-105168970 GCGGCGGGGGCACGGGGCCTCGG 0: 1
1: 0
2: 7
3: 55
4: 511
1122975437_1122975465 28 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975465 14:105168959-105168981 ACGGGGCCTCGGGGTCAGCGCGG 0: 1
1: 0
2: 0
3: 23
4: 128
1122975437_1122975447 -2 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975447 14:105168929-105168951 CGCCCCCCAGGGCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 15
4: 216
1122975437_1122975457 9 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975457 14:105168940-105168962 GCGCCCGGGCGGCGGGGGCACGG 0: 1
1: 1
2: 15
3: 66
4: 572
1122975437_1122975446 -5 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1122975437_1122975454 3 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975454 14:105168934-105168956 CCCAGGGCGCCCGGGCGGCGGGG 0: 1
1: 1
2: 31
3: 47
4: 412
1122975437_1122975466 29 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975466 14:105168960-105168982 CGGGGCCTCGGGGTCAGCGCGGG 0: 1
1: 0
2: 1
3: 33
4: 252
1122975437_1122975459 11 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975459 14:105168942-105168964 GCCCGGGCGGCGGGGGCACGGGG 0: 1
1: 0
2: 6
3: 75
4: 549
1122975437_1122975450 1 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975450 14:105168932-105168954 CCCCCAGGGCGCCCGGGCGGCGG 0: 1
1: 0
2: 2
3: 31
4: 340
1122975437_1122975456 4 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975456 14:105168935-105168957 CCAGGGCGCCCGGGCGGCGGGGG 0: 1
1: 2
2: 4
3: 98
4: 610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975437 Original CRISPR CGCGCGCCGGGCCGGGGCGC TGG (reversed) Intergenic
900189866 1:1348818-1348840 CCCGCGCGGGGACGGGGCGGGGG - Intronic
900190080 1:1349519-1349541 CGCGCGCGGGGGCGGGGCCGGGG - Intergenic
900191604 1:1354554-1354576 CGTGGCCCGGGTCGGGGCGCAGG - Intronic
900199803 1:1399372-1399394 CACGCGACGGGGCGGGGCGGTGG - Intergenic
900207019 1:1435939-1435961 CGGGAGCCGGGCGGGGGCGCGGG + Intronic
900344801 1:2205456-2205478 CGCGCGCCGGGCTGGGCCTGTGG - Intronic
900349665 1:2228488-2228510 CGCGCGGGGGGCCCGGGCGGCGG + Intergenic
900514205 1:3073645-3073667 CGTGGGCCGGGTCGGGGAGCGGG + Intronic
901057624 1:6456015-6456037 GGCGCGGCGGGCGGGGGCGGCGG - Intronic
901066602 1:6497351-6497373 CGGGCGGCGGGCGGGGGCGCCGG + Intronic
901242875 1:7704972-7704994 CGGGGGCGGGGCCGGGGCGTGGG + Intronic
901332811 1:8423873-8423895 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
901433872 1:9234704-9234726 CGGGGGCGGGGCGGGGGCGCCGG - Intergenic
901641319 1:10694528-10694550 CGCGGGCCGGGCCGAGGAGGCGG - Intronic
901696725 1:11013057-11013079 CGCGGCCCGGGGTGGGGCGCAGG - Intronic
901797964 1:11691578-11691600 TGCGCGCCGGGCCCGGCCCCGGG + Exonic
901930793 1:12595395-12595417 CGGGCGCGGGGCGGGGCCGCGGG + Intronic
902476732 1:16692453-16692475 GGCGCGGCGGGCCGGCGGGCGGG + Intergenic
902690621 1:18108237-18108259 CGTGCGCGGGGACGGGGTGCCGG + Intronic
902770087 1:18640828-18640850 GGCGCGCCGGGCCGGGGGCTGGG + Intronic
902870643 1:19311939-19311961 GGCGCGCACGGCCGCGGCGCTGG + Exonic
903072171 1:20731969-20731991 CGGGAGCCGGGCAGGGGCGGGGG - Intronic
903153280 1:21428198-21428220 GCCGGGCCGGGCCGGAGCGCGGG + Intergenic
903153302 1:21428267-21428289 CGCGCCCCGCGCCCGGGCCCCGG + Intergenic
903184748 1:21622612-21622634 CGCGGGGCGGGGCGGGGCGGGGG + Intronic
903349980 1:22711404-22711426 CGCGGGCCCGGCCGTGGCGGGGG + Intronic
903413804 1:23168195-23168217 AGCGCGTCGGGCCGGCGTGCGGG - Intronic
903514779 1:23902974-23902996 CTCGCGCCGCGCCGGGGCCTCGG + Intronic
903628244 1:24746016-24746038 CGGGCGGCGGACCGGAGCGCTGG - Intronic
904215433 1:28914886-28914908 CAGGCCCCGGGCCGGGGCGCGGG + Intronic
904483293 1:30807391-30807413 CGGGCGGCGGCCCGGGGCGGGGG - Intergenic
904542011 1:31239644-31239666 GGCGCGCCGGGCGGCGGGGCCGG + Intergenic
904619023 1:31764368-31764390 CGCGGGCCGGGCCCGGGAGGGGG + Intronic
904619031 1:31764391-31764413 CGCGCGCCGGGCCGGGCGCGAGG + Intronic
904641912 1:31937849-31937871 GCCGGGCCGGGCCGGGGCGGGGG - Intronic
904822920 1:33256738-33256760 CGGGGGCCGGGCCGGGGCGCGGG + Intronic
905442792 1:38005580-38005602 CCCGCGGCGGGCTGGGGGGCCGG - Intronic
905789679 1:40783592-40783614 AGCGCGCGGGGCCGGGAAGCCGG - Intergenic
905803660 1:40861483-40861505 CGCGCGCGGGGCCCAGTCGCTGG + Exonic
905862669 1:41361592-41361614 CGTGCGCAGGGCCGGCGCCCGGG + Intergenic
905867050 1:41382202-41382224 ACCGGGCCGGGCCTGGGCGCGGG - Exonic
905960057 1:42035808-42035830 TGCGCGCCGGGCCGGGGCGGCGG + Intronic
906062533 1:42958180-42958202 CGCGCGCCGGGGCCGGGGCCGGG + Intronic
906377037 1:45304103-45304125 GGCGCGCGGGGCCGCGGGGCAGG - Intronic
906615835 1:47232247-47232269 CGCGGGGCGGGCGGGGGAGCGGG - Intergenic
907909720 1:58815407-58815429 CGCCCGCAGCGCCGGGCCGCGGG + Intergenic
910427621 1:87132359-87132381 CGGGGGCCGGGCAGGGGCGGTGG + Intronic
911725288 1:101236370-101236392 CACTCGCCGGGCCGCGGCTCAGG + Intergenic
912337533 1:108876882-108876904 AGCGGGGCGGGGCGGGGCGCTGG - Exonic
912514580 1:110210109-110210131 AGCGCGCAGGGGCGGCGCGCTGG + Intergenic
912682720 1:111739320-111739342 CGGGCGCAGGGGCGGGGAGCCGG - Exonic
913109238 1:115642445-115642467 CGCGTGCCGGGGCGGCGGGCAGG + Intronic
913131009 1:115838560-115838582 CCCGCGCCAGGGCGAGGCGCAGG - Exonic
913222109 1:116667794-116667816 CGAGCGCGGGGCCAGGGCGGCGG + Intergenic
913274173 1:117121714-117121736 GGCGTCCCGGGCCGAGGCGCGGG - Exonic
913578126 1:120197408-120197430 CGCGCGGAGGGCTGGGGCCCGGG + Intergenic
913630045 1:120700944-120700966 CGCGCGGAGGGCTGGGGCCCCGG - Intergenic
914560043 1:148808828-148808850 CGCGCGGAGGGCTGGGGCCCCGG + Intronic
914612790 1:149321387-149321409 CGCGCGGAGGGCTGGGGCCCCGG - Intergenic
914803103 1:150974578-150974600 CCCGCGCGGGGCTCGGGCGCCGG + Intronic
914824758 1:151132769-151132791 CGCGGGCCGGGCGGGGGCAGAGG + Exonic
915161262 1:153922521-153922543 GGCGCGCCGTGCCGGGGTGGGGG + Intronic
915616967 1:157046161-157046183 CGCGGGCCGGGCCGGGGATCCGG - Intergenic
916121489 1:161532529-161532551 TGCGGGGCGGGCGGGGGCGCAGG - Intergenic
916174136 1:162023773-162023795 TGCGCGCCGGGACGGGCGGCGGG + Exonic
916588249 1:166166468-166166490 CGCGCGCCCTGCCGGAGCGAGGG - Exonic
917883981 1:179365713-179365735 CGCGGGCCAGGCCAGTGCGCAGG - Exonic
921029705 1:211326772-211326794 CTGGGGCGGGGCCGGGGCGCGGG - Intronic
922505319 1:226122490-226122512 CCCAGGCCGGGCCGGGGCACTGG - Intergenic
922528996 1:226328645-226328667 AGCGCGCCGGGCCTGGGAGGAGG - Intergenic
922648614 1:227318111-227318133 CCCGCACCGGGCCGCCGCGCCGG + Exonic
922821304 1:228487520-228487542 CGCGCGCTGGCACAGGGCGCAGG - Exonic
923055922 1:230425995-230426017 GGGGCGGCGGGCCGCGGCGCGGG - Intergenic
923673926 1:236064608-236064630 CGCGCCCCGGGCCGTGACCCCGG - Intronic
1062843719 10:689462-689484 CGCGGCCCGGCCCGGGGCGGGGG + Intronic
1063115124 10:3067482-3067504 CTGGGGCCGGGCGGGGGCGCGGG + Intronic
1064443191 10:15371326-15371348 CGGGCCCGGGGCCTGGGCGCGGG - Intergenic
1064764774 10:18659613-18659635 CGAGCACCGGGGCGGGCCGCGGG - Exonic
1065024494 10:21527197-21527219 CGTGCGCCGGGCCGGGCAGCTGG + Intergenic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065140504 10:22714570-22714592 CGCGCGCCGGGTCCAGCCGCGGG - Intergenic
1065186316 10:23173758-23173780 GGCGCGCGGGGCCGGAGCACCGG + Intergenic
1065342891 10:24723395-24723417 CGGGCGCCCGGCGGGGGCGGAGG - Intronic
1065712814 10:28533459-28533481 GGCGCGCCGGGCCCAGGTGCCGG + Exonic
1066220552 10:33334236-33334258 CCCGCCCCGGACCGGGGCTCAGG - Intronic
1066464398 10:35640327-35640349 GGCGCGGCGGGCGCGGGCGCGGG - Exonic
1067682682 10:48450621-48450643 CCCGCGCCGGGCCTGGTCCCCGG - Exonic
1067694336 10:48524152-48524174 GCCGCGCCGCCCCGGGGCGCAGG - Intronic
1069486553 10:68827511-68827533 TGCGCGCGGGTCCGCGGCGCTGG - Intergenic
1069495586 10:68900928-68900950 CGCGCGCTGGGCGGGTGCGTGGG - Intergenic
1069544488 10:69318807-69318829 CGCGCCCCGGGCCGAGGGGGAGG + Intronic
1069664509 10:70145761-70145783 CGCGCGGCCCGCGGGGGCGCTGG - Exonic
1069744334 10:70705415-70705437 CGCCAGCCGGGCTGGGGCTCAGG + Intronic
1070179257 10:73998421-73998443 CGCGACGCGGGCCGGGGCCCCGG - Intronic
1070800665 10:79242977-79242999 CGGGCGGCGGGCTGGGGGGCGGG + Intronic
1071086832 10:81875260-81875282 CGCGGGCCGGGCGCGGGCGCGGG - Intergenic
1072003657 10:91221105-91221127 CGCCCGCCCGGCAGGTGCGCGGG - Intronic
1072591489 10:96832257-96832279 CGTGCGCGGGGCCGCGGCGGAGG + Intronic
1072650621 10:97292399-97292421 CGGGGGTCGGGCCTGGGCGCTGG - Intronic
1073242464 10:102067245-102067267 GGCGGGCCGGGCTGGGGGGCAGG + Exonic
1073403413 10:103276969-103276991 CGCGCGACGACCTGGGGCGCCGG - Intergenic
1073491353 10:103855363-103855385 GGCGCGCCGGGCCGGGGTGGCGG - Exonic
1074618550 10:115093723-115093745 GTCTCGCCGGGCAGGGGCGCCGG + Exonic
1074772430 10:116742627-116742649 GGCGGGCCGGGGCGGGGCCCGGG - Intergenic
1075144473 10:119872190-119872212 TGCGCCCGGGGCCGGGGCCCTGG + Intronic
1075587178 10:123666381-123666403 CGCGCCCCGCGCCGGCGCTCAGG - Exonic
1075645060 10:124091900-124091922 CGCCGGCCGGCCCCGGGCGCAGG + Intronic
1075690236 10:124389332-124389354 CGTGCGCGAGGCCGGGGCTCGGG - Intergenic
1075802279 10:125160739-125160761 AGGGCGCGGGGCCGGGACGCGGG - Intronic
1076683745 10:132187527-132187549 CCCGGGCTGGTCCGGGGCGCGGG + Intronic
1076792915 10:132786241-132786263 CGCGGGCGGGGGGGGGGCGCCGG - Intergenic
1076850054 10:133088289-133088311 GGCGCGCGGGGCGGGGGCCCTGG - Intronic
1076879069 10:133231125-133231147 CGCGCGCCCGTCCGCGGCCCCGG + Exonic
1076985980 11:236370-236392 CGGAGGCGGGGCCGGGGCGCCGG - Exonic
1077016312 11:400503-400525 GGGGCGCGGGGCAGGGGCGCGGG - Intronic
1077016318 11:400516-400538 CGCTCTGCGGGCGGGGGCGCGGG - Exonic
1077253866 11:1572134-1572156 CGCCCGCCGAGCCGCGGGGCTGG - Intergenic
1077360424 11:2138194-2138216 TGCGGGCCGGGCCGGGGCCGGGG - Intronic
1077404612 11:2377497-2377519 CGCGGGCCGGTCCTGGGCGGCGG - Exonic
1078057395 11:8019211-8019233 TGCGGGCCCGGCCGAGGCGCGGG - Intergenic
1078498338 11:11842301-11842323 TGCGGGCCCGGCCGGGGTGCAGG + Intronic
1078729635 11:13963325-13963347 CCCGCGACGGCCCGGGACGCTGG - Intronic
1078771807 11:14358732-14358754 AGCGGGCCTGCCCGGGGCGCCGG - Intronic
1079308761 11:19346431-19346453 CGGGCGGCGGGCTAGGGCGCGGG + Intergenic
1079592017 11:22192945-22192967 AGCCAGCCGGGCCGGGGGGCGGG + Intergenic
1080540351 11:33258175-33258197 GCCGCGCCTGGCCGGGGCCCGGG + Intronic
1081705527 11:45180542-45180564 CGGGCGCCCGGGCGGGGCGGTGG - Intronic
1083289226 11:61680525-61680547 GGCGGGCCGGTCCTGGGCGCGGG + Intronic
1083303748 11:61752528-61752550 CGCGGGCCGGCAGGGGGCGCTGG + Intergenic
1083342374 11:61967237-61967259 CGCGCGCTGGGGCGGGCCGGGGG - Intronic
1083667890 11:64285396-64285418 GGCGCGCCGGGGCGAGGGGCGGG + Intronic
1083807531 11:65084004-65084026 CGCGCCCGGGGCGGCGGCGCTGG - Exonic
1083813292 11:65117377-65117399 CGGGCGCCGGGCCGGAGCTGAGG + Exonic
1083842881 11:65314826-65314848 CGCGGGCCGGGGCGGGGCTGCGG + Exonic
1083883008 11:65557788-65557810 CGCAGGCGGGGGCGGGGCGCTGG - Exonic
1083883091 11:65557988-65558010 GGCGCGCCCGGGCGGGGCGAGGG + Exonic
1083920891 11:65780982-65781004 CGCGGGGCGGGGCGCGGCGCGGG + Intergenic
1083997227 11:66278430-66278452 CCCGCGCCGGGCGGCGGCCCGGG - Exonic
1084014882 11:66372177-66372199 CCCGAGCCGGGCCCGGGCGGGGG + Intronic
1084074456 11:66762279-66762301 CGGGCGCACAGCCGGGGCGCCGG + Intronic
1084086306 11:66856905-66856927 CCCGCGCCGGCCCGGGCCTCGGG + Intronic
1084171273 11:67401969-67401991 GGCGCGGCGGCCCGGGGGGCGGG + Intronic
1084888119 11:72223828-72223850 CCCGCGCCGCCCCGGGGAGCCGG - Intronic
1084973068 11:72781794-72781816 GGCGCGCGGGGCTGGGGCCCGGG - Intronic
1085295667 11:75430329-75430351 CACGAGCCCGGCCGGGGCGGCGG - Exonic
1085503137 11:77040420-77040442 CGCGCGCAGGGCCCGGGCCGTGG - Exonic
1085641613 11:78196523-78196545 CGCGCGGGGGCCCGGGGGGCCGG - Exonic
1085666291 11:78417888-78417910 CGCGCTCGGGGCGGGGGAGCGGG - Intronic
1086337153 11:85811243-85811265 GGCGGGCCGGGGCGGGGAGCGGG - Intergenic
1089453222 11:118610845-118610867 TGTGCGCAAGGCCGGGGCGCCGG - Intronic
1089533856 11:119149219-119149241 CCCGCCCCGGCCCGGGCCGCCGG + Exonic
1090238272 11:125165117-125165139 CGCTGGCCGGGCAGGGGAGCGGG - Intronic
1090817959 11:130314972-130314994 CGCGCTCGGGGGCGGGGCTCGGG + Intergenic
1091108471 11:132943912-132943934 CGCGCGCGGGCCCGGACCGCCGG + Intronic
1091286649 11:134411998-134412020 AACGAGCCGGGCCGGGGCGGCGG - Intergenic
1091460865 12:642853-642875 GGCGAGCCGGGCAGGGGAGCGGG - Intronic
1091616184 12:2052885-2052907 CGCCCGCCCGCCCGGCGCGCCGG - Intronic
1091616186 12:2052887-2052909 GGCGCGCCGGGCGGGCGGGCGGG + Intronic
1091740775 12:2959272-2959294 CGGGCGAGGGGCCGGGCCGCCGG - Intergenic
1092184679 12:6470308-6470330 CACGGGCGGGGCAGGGGCGCAGG - Intronic
1092256148 12:6927848-6927870 CCCGCGCCGGGTCGGGGCCTCGG + Intronic
1093464863 12:19439413-19439435 CGGGCGCCGGGCGGGGGCGGGGG + Intronic
1093925301 12:24903120-24903142 CGCGCGCCAGGGCCAGGCGCAGG + Intronic
1094565031 12:31591178-31591200 CGCGGGGCGGGCGGGGGCGCCGG + Intergenic
1095741458 12:45611224-45611246 CGCGCGCCTCGCCGGGGCTGAGG + Intergenic
1095875919 12:47079888-47079910 CGGGAGACGGGCTGGGGCGCCGG + Intronic
1096116810 12:49059959-49059981 GGCGCGGGCGGCCGGGGCGCTGG - Intergenic
1096241333 12:49961806-49961828 CGGGCGCGGGGCCGGCGCGGGGG - Intergenic
1096691684 12:53325538-53325560 CGCGCGCCCAGCCGGAGGGCAGG + Intergenic
1096870318 12:54588586-54588608 AGCGCGCCGGGCTGGGGCCGGGG - Exonic
1100611395 12:96194345-96194367 CGCGCACGGGGCCGGGGCGGCGG + Intergenic
1101340873 12:103841108-103841130 GGCACGCGGGGCCGGGGCGAGGG - Exonic
1101371848 12:104137939-104137961 AGCGGGCCGGGCCGGGGAGCGGG - Intronic
1101910572 12:108857666-108857688 CGCGCGCCGGCGCGGGAGGCGGG - Intergenic
1102025801 12:109713886-109713908 CGCGCGCCGGCCGGGGGAGGCGG + Intergenic
1102101587 12:110282034-110282056 CTCCCGCGGGGCCGGCGCGCTGG - Intronic
1102136930 12:110583163-110583185 CGCGCGTCGGGCAGGGGCGGCGG - Exonic
1102519817 12:113471279-113471301 CGCGCGCAGGGTGGGCGCGCAGG + Intronic
1102853908 12:116277342-116277364 CGCGCCCCGGGCCGGCGCTGCGG + Intergenic
1102924933 12:116819391-116819413 AGCGGGGCGGCCCGGGGCGCGGG + Intronic
1103074232 12:117969160-117969182 CGCGCACCTGGCCGGGGGGCGGG + Intergenic
1103085828 12:118061209-118061231 GACGCGCGGGGGCGGGGCGCAGG + Intronic
1103339951 12:120215930-120215952 CGGGCGCTGGGCCTGGGGGCTGG + Intronic
1103348350 12:120265754-120265776 CGCGCGGCGGGCGCGGGCGCGGG - Exonic
1103764616 12:123271492-123271514 CGCGCGCCCGGCCCCGGCCCGGG - Intronic
1103779487 12:123389367-123389389 GGCGCGGCGGGGCGGGGAGCGGG - Intronic
1103800317 12:123533626-123533648 CGGGCGGCGGGCGCGGGCGCGGG + Exonic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1104854209 12:131894600-131894622 TGCGCGCCGGGCCGGGAGGCGGG - Intergenic
1104980148 12:132570057-132570079 CGGGAGCCGGGCGGGGGCCCCGG - Exonic
1104990147 12:132620102-132620124 TGGGCCCCAGGCCGGGGCGCAGG - Intronic
1105943407 13:25170687-25170709 GGCGCGCCGAGCCGGGGCCCGGG - Exonic
1106776713 13:33016448-33016470 CGGGCGGCGCGGCGGGGCGCTGG - Exonic
1106956325 13:34942658-34942680 AGCGGGCCGGGCTGAGGCGCAGG + Exonic
1108478442 13:50843455-50843477 CGCGGGCCCGGCCGGGGCCCGGG - Exonic
1108484492 13:50910231-50910253 CCCGCGCCGGGCCGGGTAGTGGG - Intronic
1108518273 13:51222574-51222596 GCCGCGCCGGGCCGGGCCGCGGG + Intronic
1108542061 13:51453621-51453643 CTCGCGCCGGGGCGGCGCGCCGG - Intronic
1109284871 13:60397627-60397649 CGGGCGGCGGGCCTGGGCCCCGG + Intronic
1110318641 13:74135703-74135725 CGCGGGGCGGGCCGGGCCGGGGG - Intergenic
1112012039 13:95301023-95301045 TGCGCCCCGGGGCGCGGCGCAGG - Intronic
1112091664 13:96090357-96090379 CCCGCGGCCGGCCGGGGCGGCGG + Intergenic
1112290834 13:98143149-98143171 CGGGCGCTCGGCTGGGGCGCGGG + Intronic
1112506891 13:99981002-99981024 CGCCGGTCGGGCCTGGGCGCTGG - Intergenic
1112652623 13:101416063-101416085 TGCCGGCCTGGCCGGGGCGCGGG - Intronic
1113378646 13:109784865-109784887 CGCGCACCGGCCCGGGGCTCAGG + Exonic
1113724521 13:112588183-112588205 CGCACGCGCGGCCGCGGCGCAGG - Intergenic
1113985692 13:114314264-114314286 CGCGCGCCCGGGCGCGGCTCCGG - Intergenic
1114519021 14:23321519-23321541 GGGGCTCCGGGCCGGGGCGGCGG + Exonic
1114865996 14:26597143-26597165 GGGGCGCGGGGCAGGGGCGCAGG + Intronic
1115120063 14:29927862-29927884 CGAGCGCCGGGCGGGGGCCGGGG + Intronic
1115257760 14:31420659-31420681 CGCGCCCTGCGCCGGGCCGCTGG + Intronic
1115752923 14:36508382-36508404 GGCGGGGCGGGGCGGGGCGCGGG + Intronic
1115855051 14:37622231-37622253 CGCGGGGCGGGCCGGGCCGGGGG - Intronic
1117298079 14:54396989-54397011 CGCGGGCTCGGCCGGGGCACCGG + Exonic
1118607720 14:67515527-67515549 AGCGGGCCGGGCCGGCGAGCGGG - Intronic
1118725782 14:68628297-68628319 CTCGGGCCGCCCCGGGGCGCGGG + Intronic
1118776817 14:68978726-68978748 GGAACGCCGGGCCGGAGCGCGGG - Intronic
1119003910 14:70907540-70907562 CGGGGGCCGGGCCGCGGCTCCGG + Exonic
1120167861 14:81220265-81220287 CGCGGGGAGGGCGGGGGCGCCGG - Intronic
1120521866 14:85533831-85533853 CGCCCGCAGCGTCGGGGCGCGGG - Intronic
1121226179 14:92323403-92323425 GGCGCGGCGGCGCGGGGCGCGGG + Intronic
1121417461 14:93788890-93788912 CGCGCGGCTGCCCGGGGCACTGG + Intergenic
1121616985 14:95319915-95319937 CGCGGGCGGGGCGCGGGCGCGGG + Intergenic
1121648169 14:95535177-95535199 CGGGCGGCGGGCTCGGGCGCGGG + Exonic
1121648234 14:95535459-95535481 GCCGCGCCGGGCTGGGGAGCGGG + Intronic
1121803853 14:96797482-96797504 CGCGCGCCGAGCCGGGGGCGCGG + Intronic
1122265794 14:100546346-100546368 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122265803 14:100546363-100546385 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122265812 14:100546380-100546402 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122265821 14:100546397-100546419 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122265830 14:100546414-100546436 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122265839 14:100546431-100546453 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122265848 14:100546448-100546470 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122265857 14:100546465-100546487 CGAGGGCCGGGGCGGGGCGAGGG - Intronic
1122399251 14:101457742-101457764 CGCGGGCCTGGCCTGGGCCCAGG + Intergenic
1122544959 14:102517103-102517125 CGCCCCCGGGGCCAGGGCGCTGG - Intergenic
1122624179 14:103075712-103075734 CTCGAGCCGGGAGGGGGCGCTGG + Intergenic
1122779121 14:104136263-104136285 GGCGGGCGGGGCCGGAGCGCGGG + Intergenic
1122888864 14:104723622-104723644 AGCGCGCCCGGGCGGGACGCGGG + Intergenic
1122960971 14:105093511-105093533 CGCGGGCCGGGGGCGGGCGCTGG - Intergenic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1122993246 14:105248790-105248812 CTCGCGCCGCGCCGGGGCCTCGG - Exonic
1123021063 14:105398250-105398272 CGCGCGCGGGGCCGCAGGGCTGG - Intergenic
1123038048 14:105479242-105479264 TGGGGGCCGGGCAGGGGCGCGGG + Intronic
1124109530 15:26773153-26773175 CGCGCGCGGGCGCGGGGCGGGGG + Intronic
1124118268 15:26867395-26867417 GGCGCGCTGGGCCGGGGCAGTGG + Intronic
1124375857 15:29128266-29128288 CGCGTGCAGAGCCGGGGCGGGGG - Intronic
1124628956 15:31326543-31326565 CGCGCGCAGGGCCCGGGACCGGG + Intergenic
1124696762 15:31870344-31870366 CGACCGCGGGGCCGGGGCGCGGG - Intronic
1125589222 15:40844201-40844223 CGCGCGCAAGGCCGAGGCGCAGG + Intronic
1126109429 15:45166994-45167016 AGCGCGCCAGGCCGGGGAGCGGG - Intergenic
1127207306 15:56733747-56733769 CACGCGCCGGTCCGGGGCGAGGG + Intronic
1127433288 15:58933199-58933221 CCCGGCCCGGCCCGGGGCGCGGG + Intronic
1127488158 15:59438124-59438146 CGCGCGCCGGGCCAGGCGGCAGG + Intronic
1127606595 15:60592753-60592775 CGGGCGAGGGCCCGGGGCGCGGG - Intronic
1127753423 15:62067989-62068011 TGGGCCCGGGGCCGGGGCGCGGG - Exonic
1127763637 15:62164602-62164624 TGGGCCCGGGGCCGGGGCGCGGG + Exonic
1128067897 15:64775703-64775725 CGCGCGGCGGGCGGGGGAGGGGG - Intergenic
1128089809 15:64911858-64911880 CGTCCGCCGGGGCGGGGCCCGGG - Intronic
1128547525 15:68578488-68578510 CTCGCGCTGGCCCGGGGCACAGG - Intergenic
1128582227 15:68818343-68818365 AGCGCGGCGGGGAGGGGCGCAGG + Intronic
1128743175 15:70097015-70097037 CGGGCGCCGGGGCCGGGCGGCGG + Exonic
1129273866 15:74433201-74433223 CGAGCTCCGGGCCGGGGCGGGGG + Intronic
1129313291 15:74726550-74726572 CCCGCGCCGGGCCGGGGAATGGG - Intergenic
1129440574 15:75578585-75578607 CGCGAGCCGGGCACGGGAGCGGG + Intronic
1129644832 15:77420204-77420226 CGCGCGGAGGGGCGGCGCGCGGG - Intergenic
1129803828 15:78438040-78438062 CGCGAGCGGGGGCGGAGCGCTGG - Intronic
1130040878 15:80404474-80404496 CGCCCGCTTGGCAGGGGCGCGGG - Exonic
1130411727 15:83653841-83653863 AGCGCGCGGGGCCGCGGCGACGG - Intergenic
1131160569 15:90102321-90102343 CTCGCGGCCGGCCTGGGCGCCGG - Exonic
1131515282 15:93072875-93072897 GGCGCGCGGGGCCGGGTCCCTGG - Intronic
1132320156 15:100919516-100919538 CGGGCGCCGGGCGCGGGCTCTGG - Intronic
1132365187 15:101251752-101251774 CGCGCGCGGGGACGCGGGGCCGG + Exonic
1132480583 16:164724-164746 CGCGGGGCGGGCGGGGCCGCGGG + Intronic
1132482223 16:172479-172501 CGCGTGCCAGGCCGGGGCGGGGG + Intergenic
1132483071 16:176283-176305 CGCGTGCCAGGCCGGGGCGGGGG + Intergenic
1132499935 16:280757-280779 AGCGGGCCGGGCAGGGGCGGGGG + Intronic
1132512843 16:352725-352747 CGGGGGCGGGGCCGGGGCGCGGG + Intergenic
1132527978 16:426727-426749 AGCGGCCCGGGCCGGGGCGTGGG + Intronic
1132552784 16:560265-560287 CGCGCGGGCGGCGGGGGCGCGGG + Intergenic
1132560249 16:590198-590220 CGGGCGCAGGTGCGGGGCGCGGG + Intronic
1132585769 16:705292-705314 CGGGCCAGGGGCCGGGGCGCGGG + Intronic
1132585994 16:705957-705979 CGGGGGCCGGGGCGGGGCGGGGG - Intronic
1132641857 16:981710-981732 CGGGCGCGGGGCGGGGCCGCGGG + Intergenic
1132719508 16:1308980-1309002 CTGGCCCTGGGCCGGGGCGCGGG - Exonic
1132719654 16:1309492-1309514 GGCGCGCGGCGGCGGGGCGCGGG + Intronic
1132719738 16:1309785-1309807 CGGGGGCCGGGCCGGGGCCGCGG + Intronic
1132719765 16:1309861-1309883 GGCTCGGCGGGGCGGGGCGCGGG - Intronic
1132815806 16:1826180-1826202 TGCGCACCCGCCCGGGGCGCTGG + Intronic
1132842367 16:1984315-1984337 GACGCGCGGGGCCGGGGCGCGGG + Exonic
1133188512 16:4116564-4116586 CGCGCGCTGGGCTGGGGCTGCGG + Intergenic
1133213001 16:4273419-4273441 CGCGCGCTCGGCCGGCCCGCAGG + Intergenic
1133304833 16:4802352-4802374 CGCCCGGCGGGGCAGGGCGCGGG + Intronic
1133784449 16:8963632-8963654 CGCGGGCCGGCCGGGGGCGGAGG + Intronic
1134134140 16:11668567-11668589 CTCGGGCCGGGCGGGGGCGCCGG + Intronic
1134149832 16:11797057-11797079 CGCGGGGGGGGCGGGGGCGCGGG + Intronic
1135572207 16:23557787-23557809 CGGGCGCCGGGCCGGGGCTGAGG + Intronic
1136003574 16:27313871-27313893 CGGGCGCCGGGGCGGGGAGCAGG + Intronic
1136110796 16:28062897-28062919 CGCGCGCCGTTCCGGGGCCGGGG - Intronic
1136129722 16:28211992-28212014 CGGCCGCCGGGCTGCGGCGCTGG + Intergenic
1136414682 16:30096042-30096064 CGCGGGCTGGGCAGGGGCGCGGG + Exonic
1136536387 16:30902308-30902330 GGCGCGCCAGGCCCGGGCCCTGG + Exonic
1137617805 16:49857357-49857379 AGCACGCGGGGCCGGGGCTCGGG + Intronic
1137665271 16:50246038-50246060 CGGGAGCCGGGGCGGGGGGCTGG - Intergenic
1137787602 16:51151367-51151389 TGCGCCCGGGGCCGGGGAGCCGG - Intronic
1139511603 16:67431196-67431218 CGGGGGCCGGGCCGGGGAGCGGG - Exonic
1140097093 16:71884245-71884267 CGCGCGCCGGGCCGCGGGGAAGG - Intronic
1141116818 16:81315686-81315708 CGCGGGCCCGGCCTGGGCGAGGG - Intronic
1141452703 16:84116606-84116628 CGGGGGCCGGGCCGGGTCGGGGG - Intronic
1141620847 16:85235879-85235901 CCAGCGCGGGGGCGGGGCGCGGG - Intergenic
1142145283 16:88490481-88490503 CGCTCGCCGTGCTGGGGAGCGGG + Intronic
1142292893 16:89201006-89201028 CGCGGGGCGGCCTGGGGCGCTGG - Intronic
1142631331 17:1228671-1228693 CGAGCTCGGGGCCGGGGAGCGGG - Intronic
1142670668 17:1486075-1486097 TCCGCGGCGGGCCTGGGCGCTGG + Intronic
1142760914 17:2041590-2041612 CGCGGGCCGGCCCGGGGCGTGGG - Exonic
1142836861 17:2593863-2593885 GGCGCGCTGGGCCCGGGCCCGGG - Exonic
1143030362 17:3964139-3964161 GCCGGGCCGGGCCGGGGAGCGGG - Intronic
1143321158 17:6070244-6070266 CGCGGGCCGGGGCAGGGCGTGGG + Intronic
1143390447 17:6556506-6556528 GGCGAGCGGGGCGGGGGCGCGGG - Intergenic
1144339969 17:14302680-14302702 CGCCCGCCAGGCGGAGGCGCCGG - Intronic
1145248263 17:21283943-21283965 CAGGCGCCCGGCCAGGGCGCGGG - Intergenic
1145750005 17:27349043-27349065 CGTCCGCCGCGCTGGGGCGCGGG + Intergenic
1145754348 17:27380070-27380092 CGGGTGCAGGGCCTGGGCGCAGG + Intergenic
1145937987 17:28726289-28726311 GGCGGGCGGGGCGGGGGCGCGGG - Intronic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146057695 17:29589426-29589448 CGGGCGGCGGGCCCGGGCGGCGG + Exonic
1146271371 17:31487967-31487989 CTCGCGCCGGGGCGGGGCGGGGG - Intronic
1146339671 17:32007857-32007879 CCCCCGCCGGGCCCGTGCGCTGG - Intronic
1146339674 17:32007863-32007885 CACGGGCCCGGCGGGGGCGCGGG + Intronic
1146736244 17:35241799-35241821 CGCAGTCTGGGCCGGGGCGCTGG - Intergenic
1146909907 17:36641834-36641856 CGCGAGCCGGGCCTGGGCCAGGG - Intergenic
1147139625 17:38453879-38453901 CGCGCGCCGCGCGGGGGCCCGGG - Intronic
1147192819 17:38747576-38747598 CCGGCGCCGGGACGGGGAGCGGG + Intronic
1147353167 17:39868152-39868174 CGCGCGCGGGGGCGGGGCGACGG - Exonic
1147393124 17:40122208-40122230 CGAGCTCCGGGGCGGGGGGCCGG + Intergenic
1147740849 17:42670220-42670242 CGCGCGGCGGGGCCGGGGGCGGG + Exonic
1148081058 17:44967921-44967943 CCCGCGCGGGGCCCCGGCGCCGG - Exonic
1148108849 17:45133148-45133170 CGGGTGCCGGGCTGGGGTGCCGG - Intronic
1148183110 17:45620683-45620705 CGCGCCCCCGGCCGCGGCCCCGG - Intergenic
1148206771 17:45784367-45784389 GCCGGGCCGGGCCGGGCCGCGGG + Intronic
1148265741 17:46225008-46225030 CGCGCCCCCGGCCGCGGCCCCGG + Intronic
1148271727 17:46266918-46266940 CGCGCGCGCGGCCGGGCGGCGGG - Intergenic
1148323704 17:46771702-46771724 CGCGCCCCCGGCCCCGGCGCCGG + Intronic
1148337475 17:46851436-46851458 CCCGCGACGGGGCGGGGCGAGGG + Intronic
1148370972 17:47099941-47099963 CGCGCCCCCGGCCGCGGCCCCGG + Intergenic
1148549408 17:48541804-48541826 CGGGCGGCGGGCCGGGGGGGGGG - Intronic
1148818230 17:50346004-50346026 CGCGCGCCGGGGCGGGGCCGGGG - Intergenic
1148852350 17:50561258-50561280 CCCGCGGGGCGCCGGGGCGCAGG - Intronic
1149314029 17:55421967-55421989 CGGGCTCCGGGGCGGGGCGCAGG - Exonic
1149461658 17:56834113-56834135 CGCACGCCGATCCGGCGCGCGGG - Exonic
1149491010 17:57085308-57085330 GGCGCTGCGGGCCGGGCCGCGGG + Intronic
1149595356 17:57861886-57861908 CGCGCGCGGGGCCGGGACGCTGG - Exonic
1149914928 17:60600227-60600249 CGAGAGCTGGGCCGGAGCGCCGG - Exonic
1150150881 17:62808132-62808154 GGCGGGCCGGTCCAGGGCGCAGG + Exonic
1150217087 17:63476926-63476948 CCCGCCCCGGGCAGGGGCGCGGG - Intergenic
1150414435 17:64975696-64975718 CGCGCTCAGGGGCGTGGCGCGGG - Intergenic
1150423287 17:65056951-65056973 CGCGCGCCCGGCCGCGGCTGCGG - Intergenic
1150488766 17:65560886-65560908 CGCGAGCCGAGCCGGGGGCCGGG - Intronic
1150643554 17:66964865-66964887 GGCGCGGCGGGCCGGGCCGGCGG + Intergenic
1150747318 17:67825984-67826006 CCCCCCCCGGCCCGGGGCGCTGG - Exonic
1151491006 17:74432372-74432394 CGGGGCCCGGGCCGGGACGCAGG - Intronic
1151559237 17:74861769-74861791 GCCGGGCCGGGCCGGGGCGGAGG - Intergenic
1151608314 17:75154210-75154232 CTCGCGCCGGGGCGGGTGGCGGG - Intronic
1151817136 17:76476977-76476999 CGCTTGCCGCGCCGGGGCCCGGG + Exonic
1151938956 17:77281201-77281223 CGGGCGCCGGGCCTGGGAGGGGG - Intronic
1152245609 17:79183220-79183242 CGTGCGCCGGGCCGGGGGCCGGG + Intronic
1152349762 17:79778075-79778097 CGGGCGGCGGGCCGGGGCGCGGG + Intergenic
1152356513 17:79810170-79810192 CGCTCGCCCGGCCGCGGCCCCGG - Intergenic
1152552200 17:81035404-81035426 CGCGCGCCGGGCCAGGAGGCTGG + Intronic
1152552310 17:81035695-81035717 CCCGGGCAGGGCCGGGGCGGCGG + Intronic
1152625853 17:81387606-81387628 CCCGCGGCGGGGCCGGGCGCGGG - Intergenic
1152659817 17:81537043-81537065 CGCGGTCCCGGCCGGGGCGTCGG - Exonic
1152699726 17:81812961-81812983 TGCGCCCCGGGCGGGGGAGCCGG - Intronic
1152748413 17:82051632-82051654 CGCGCGCGGGGCCGGGGCGGGGG + Exonic
1152789894 17:82273275-82273297 CGGGCGGCGGGCGGGGGCGGCGG + Intronic
1152814274 17:82398165-82398187 CGCGGGCGGGGCCTGGGCGTGGG - Intronic
1152924229 17:83080079-83080101 CGGGCGCGGGGCAGGGGCTCCGG + Intronic
1153265137 18:3262292-3262314 CGCGCGACGGGAGGGGGCGCGGG - Intronic
1153565673 18:6414933-6414955 CACGCGCGGGGTGGGGGCGCGGG + Intronic
1154241597 18:12658106-12658128 GGCGGGGCGGGGCGGGGCGCCGG - Exonic
1155096460 18:22560233-22560255 CGCGCCCCGGAGCGGAGCGCCGG - Intergenic
1155096462 18:22560235-22560257 GGCGCTCCGCTCCGGGGCGCGGG + Intergenic
1155257868 18:24014478-24014500 CCCGGGAGGGGCCGGGGCGCGGG + Intronic
1156099745 18:33578740-33578762 CCCGCGCCGGTCCGCGGCGGCGG + Intronic
1157529449 18:48409192-48409214 CGCGCGCCGGGCTCGGGCGCCGG - Intronic
1158137563 18:54224143-54224165 GGAGCGCGGGGCCGGGGCCCAGG - Exonic
1158931054 18:62325345-62325367 GGCGCGCGGGGCCATGGCGCGGG - Exonic
1158954380 18:62524447-62524469 CCTGCGCCGGGCTGGGGCTCGGG - Intronic
1158954763 18:62526838-62526860 CGGGGGCGGGGCCGGCGCGCCGG - Intronic
1160592367 18:79951616-79951638 CGCGCGCGGGTCAGCGGCGCGGG - Exonic
1160691436 19:462054-462076 CGCCCGCGGGGCCGGGGAGGTGG + Intergenic
1160738699 19:676312-676334 CGCGGGGCGGGGCGCGGCGCGGG - Intergenic
1160768887 19:821716-821738 CGCGTGCTGGGCCGGGGCGCGGG - Intronic
1160820702 19:1056407-1056429 GGCGGGCCGGGCCTGGGGGCAGG - Exonic
1160939716 19:1614573-1614595 TGTGGGCCGGGCCGGGGCTCTGG + Intronic
1161210327 19:3062349-3062371 GGCGCGCGGGGAGGGGGCGCAGG - Intronic
1161249028 19:3270677-3270699 CGGGCGCCGGGCCGCGGGGTGGG + Intronic
1161265178 19:3360387-3360409 GGCGCGCCGGGCCGAGACCCGGG - Intronic
1161350102 19:3786455-3786477 CGCGCCCCGGGCGGGGTCCCGGG + Intronic
1161400771 19:4065635-4065657 CGCAGGCCGGGCCCGGGCGTGGG - Intronic
1161955046 19:7489039-7489061 GGCGCGCCGCGCCAGGGGGCGGG + Intronic
1161959560 19:7516220-7516242 GGCGGGCCGGGCAGGGGCGAGGG + Exonic
1162327882 19:10009524-10009546 GGCGAGACGGGGCGGGGCGCAGG - Intronic
1162485997 19:10960964-10960986 CGCGCGCGCAGCGGGGGCGCGGG + Intergenic
1162770412 19:12946022-12946044 TGCGGGCCGGGCCGGAGCCCGGG + Intronic
1162833107 19:13299073-13299095 CGCGCTGCTGGCCGAGGCGCTGG + Exonic
1162932040 19:13962258-13962280 CCTGCGCCGGCCCGGGGCTCAGG + Exonic
1162940542 19:14006344-14006366 CACGCGCGGGGGCGGGGCCCGGG + Intronic
1163219960 19:15911782-15911804 CCCGCTCCGGGTCGAGGCGCCGG - Intergenic
1163370333 19:16897690-16897712 CGCGCCCCTGCCCGGGGCCCGGG - Exonic
1163548395 19:17952182-17952204 CGGGCGGCGGGGCGGGGCCCAGG + Intronic
1163586917 19:18169261-18169283 CAGGCGGCGGGCCGGGGCCCGGG - Exonic
1164713436 19:30375270-30375292 CGCTCGCGGGGCCCGGGCGCGGG - Intronic
1164834728 19:31349771-31349793 CGAGCCCCGGGCCGCGGCGGCGG - Intergenic
1165129458 19:33622709-33622731 CGCGCTCGGAGCCGGGGCTCCGG + Intronic
1165227463 19:34365107-34365129 CGGGGGCGGGGCCGGGGCTCAGG + Intronic
1165349737 19:35269189-35269211 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
1165420003 19:35717951-35717973 CGTGCGCAGGGCCGGGGGGAGGG - Intergenic
1165447150 19:35862605-35862627 CGGGAGCCGGGGCGGGGCTCAGG - Intronic
1165924858 19:39320746-39320768 GGAGCGGCGGGCGGGGGCGCGGG - Intergenic
1166366406 19:42280627-42280649 CGCGGGCCGCGGCGGGGCGCCGG - Intronic
1166367391 19:42284436-42284458 CGCGCGCCGGGGGGCGGGGCGGG + Intronic
1166798984 19:45444336-45444358 AGCGCGCCCGGGAGGGGCGCGGG - Intronic
1167101609 19:47407311-47407333 CTCGCCCCGGGCCGGCCCGCGGG + Intronic
1167110401 19:47457351-47457373 CGCGCGCCTCGGCGGGGCCCGGG + Exonic
1167577714 19:50325717-50325739 GGCCAGCCGGGCCGGGGGGCGGG + Intronic
1167622708 19:50568199-50568221 CGGGCGGCGGGCGAGGGCGCGGG - Intergenic
1167628191 19:50606194-50606216 CGCGCGGCGGGCCCGCGGGCTGG + Intergenic
1168408046 19:56120933-56120955 CGCGCGCCCGGGCGGCCCGCGGG - Intronic
1168694411 19:58396570-58396592 CGCGGCCCGGGCGGGGGCGGCGG - Exonic
1168718976 19:58544602-58544624 CGCGCGGCGGGCAGCGGCCCAGG + Exonic
924962318 2:46128-46150 CGCCACCGGGGCCGGGGCGCGGG + Exonic
924962477 2:46627-46649 CGCGGCCAGGGCCGGGGCACCGG - Intronic
925984878 2:9207268-9207290 GGCGGGCGGGGCTGGGGCGCGGG - Intronic
926035104 2:9630455-9630477 CGGGCGCGGGGCCGGGGCCGGGG + Exonic
927567173 2:24123445-24123467 CGCGGGCGGTGCCGGGGCGGCGG - Exonic
927640447 2:24842232-24842254 GGTACGCCGGCCCGGGGCGCGGG - Exonic
927652430 2:24920418-24920440 CGGGCGGCGGGCTGGGGCGATGG + Intergenic
927684627 2:25161790-25161812 CGGCAGCCGGGCCGGGGTGCGGG - Intronic
927713795 2:25340856-25340878 CGCGGCCCGGGCCCGGGCCCGGG + Intronic
927811746 2:26184379-26184401 GCTGGGCCGGGCCGGGGCGCTGG + Exonic
929033878 2:37672530-37672552 GGCGCGCCGGGCGGCGGCGCTGG - Intronic
931682914 2:64767996-64768018 CGCGGGCCAGGGCGGGGAGCGGG - Intergenic
932180713 2:69643743-69643765 CGCGCGCGGGGGAGGGGCGGCGG - Intronic
933791695 2:85888659-85888681 GGCGAGCCCGGCTGGGGCGCGGG - Intronic
933858481 2:86441576-86441598 TGGGCGCCGGGGCGGGGCGGCGG + Intronic
934604322 2:95682681-95682703 CGAGCGGCGGGGAGGGGCGCAGG - Intergenic
934655992 2:96116976-96116998 CGGGCGTGGGGCTGGGGCGCCGG + Intergenic
935645330 2:105329670-105329692 CGCGGGCCGGAGCGGGGCGGCGG - Exonic
936537716 2:113324913-113324935 CGAGCGGCGGGGAGGGGCGCAGG - Intergenic
936972111 2:118186006-118186028 CGCGGGCGGGGCCGGGGCCGAGG - Intergenic
937183137 2:120013447-120013469 CGCGCGACGGGCCGGGGCGGAGG + Intronic
937261149 2:120587418-120587440 CGCGGGCCGGGCCGGGGCAGGGG - Intergenic
937369005 2:121284997-121285019 CTCGGGCCGGGCCGGCGGGCCGG - Intronic
938073079 2:128318576-128318598 CGCGCCCCGCGCCCGGGCCCCGG - Exonic
938073101 2:128318645-128318667 GCCGGGCCGGGCCGGAGCGCGGG - Intergenic
938451534 2:131425299-131425321 AGCGAGGCGGGCCGAGGCGCGGG - Intergenic
939375455 2:141359755-141359777 GGCGGGGCGGGGCGGGGCGCGGG - Intronic
939629745 2:144517117-144517139 CGCGCGCCGGGCTCCGGCGCCGG + Intronic
940211658 2:151261620-151261642 GGCGCGACGGGCCAGGGTGCAGG - Intronic
941808707 2:169734411-169734433 CGCGCCCCGCGCCTGGGCCCCGG - Intronic
942284047 2:174395939-174395961 AGCGCCCAGGGCCGGGGTGCGGG + Intronic
942458183 2:176151943-176151965 CGGGCGCCAGGCAGGGGCGCCGG - Exonic
942459048 2:176157144-176157166 CCCGCGCCGGGCTGGGCGGCCGG + Intronic
943624286 2:190181021-190181043 CCCGCCCCGGGCCTGAGCGCAGG + Exonic
945080872 2:206085517-206085539 CGCGCGGAGGCCCGGGGTGCGGG + Intronic
946395627 2:219442424-219442446 CGGGCGGGGGGCCGGGGCCCGGG - Intronic
946404057 2:219483520-219483542 CCTGCCCCGGGCCGGGCCGCGGG + Exonic
947635990 2:231681039-231681061 TCTGCGCCGGGGCGGGGCGCGGG - Intergenic
947729666 2:232420946-232420968 CGGGCGGCGGGCTGGGGCGGCGG - Intergenic
948046830 2:234951874-234951896 CCCGCGCCGGGGCGGGGCTTCGG - Intergenic
948116115 2:235495018-235495040 CTCGCGGCGCGGCGGGGCGCAGG - Intronic
948140881 2:235670915-235670937 CGCGCGCAGGGACGGGGGCCCGG + Intronic
948467383 2:238158878-238158900 CGGGAGCCGGGAGGGGGCGCGGG + Intergenic
948479101 2:238239455-238239477 GGCGGGGCGGGCGGGGGCGCCGG - Intronic
948544805 2:238719860-238719882 CAGGCGACAGGCCGGGGCGCCGG - Intergenic
948560470 2:238848197-238848219 CGCGCGCCGGGCGGGCGCCATGG + Exonic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948824640 2:240568384-240568406 TGTGCGCGGGGCCGGGGCGCGGG - Intronic
948844221 2:240675555-240675577 CCCGTCCCGGGCAGGGGCGCTGG - Intergenic
948849639 2:240699324-240699346 CCCGTCCCGGGCAGGGGCGCTGG + Intergenic
948945754 2:241218079-241218101 GGCGCGCAGGGGCGGGGCGGGGG + Intronic
948945779 2:241218133-241218155 GGCGCGCAGGGGCGGGGCGGGGG + Intronic
949014467 2:241701786-241701808 CGCACGCCGGGCGGTGGGGCCGG + Intergenic
1168757182 20:325801-325823 CGGGGGCCGGGCCGAGCCGCGGG + Exonic
1168804423 20:664150-664172 CGCGGGGCGCGCGGGGGCGCAGG - Exonic
1168855087 20:1002403-1002425 CGCGCGCGGGGAGGGGGCGGGGG + Intergenic
1169164117 20:3407686-3407708 CGCGGGCCCGGCGGGGGCGGGGG + Intergenic
1169244504 20:4015280-4015302 CGCCCGGCCGGCCGAGGCGCCGG + Intronic
1170629938 20:18057501-18057523 CGGGGGCCGGGCCTGGGCGCTGG - Intronic
1170889709 20:20367554-20367576 GGCGCGCCGGGGCGGTGCGGGGG - Intergenic
1170924682 20:20712346-20712368 CGCGCGCCGGGCGCGGGGGTCGG - Intronic
1171444818 20:25195869-25195891 TAAGCGGCGGGCCGGGGCGCTGG + Intronic
1172474568 20:35226993-35227015 GGCGCGCGGGGCCGGGGCGCGGG + Intronic
1172962194 20:38806843-38806865 CGCGCGCCAGGCCTGGGTCCCGG + Intronic
1173165960 20:40687706-40687728 CGGGCGACGGGCGGGTGCGCGGG - Exonic
1173279745 20:41618004-41618026 CGCGCGCAGGGGCGGGGGTCCGG - Intronic
1173548129 20:43914739-43914761 CGCGGGCGGGGCGGGGGCGGGGG + Intergenic
1174386694 20:50191604-50191626 GGGGCGCCGGGCGGCGGCGCAGG + Exonic
1175443687 20:59006922-59006944 CGCGCGCCTGGCCCGGGCGATGG + Intronic
1175859496 20:62142886-62142908 CACGCGCCCGGCCGGGGCCAGGG + Intronic
1175859543 20:62143082-62143104 CGTGCGCGGGGCAGCGGCGCGGG - Intronic
1175859798 20:62143938-62143960 CGCGCGCGGGGACGGGGCGCGGG + Intronic
1176068848 20:63215819-63215841 CGCGGCCGGGGCCGAGGCGCGGG - Intronic
1176128949 20:63488195-63488217 GGGGCGCCGGACCGGCGCGCGGG + Exonic
1176131763 20:63499298-63499320 CGCGGGCGGGGGCGGGGCGGGGG + Exonic
1176161868 20:63652538-63652560 CGCGGGACGGGCCGGGAGGCCGG + Intronic
1176194270 20:63830448-63830470 CGCCGGCCGAACCGGGGCGCAGG - Intronic
1176195977 20:63836442-63836464 CGCGGGCAGGGCAGGGGAGCGGG + Intergenic
1176207214 20:63895488-63895510 CGCGGCCTGGGCCGGGGCGGGGG + Intronic
1176221000 20:63969447-63969469 CGCGCGCCAGGCCTGGGCCGGGG - Intronic
1176221148 20:63969842-63969864 GCCGGGCCGGGCCGGGGCGGGGG + Intronic
1176380801 21:6111332-6111354 CGGGCGCCGGGCCGGGGCTCGGG + Intronic
1176548986 21:8213473-8213495 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1176549148 21:8214011-8214033 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1176549604 21:8215356-8215378 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
1176550449 21:8218717-8218739 CGCGCGCCGGGACCGGGGTCCGG + Intergenic
1176556879 21:8257685-8257707 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1176557041 21:8258232-8258254 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1176557495 21:8259585-8259607 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
1176567915 21:8396503-8396525 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1176568080 21:8397049-8397071 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1176568529 21:8398390-8398412 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
1176569378 21:8401756-8401778 CGCGCGCCGGGACCGGGGTCCGG + Intergenic
1176575819 21:8440722-8440744 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1176575983 21:8441269-8441291 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1176576440 21:8442619-8442641 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
1176577291 21:8445987-8446009 CGCGCGCCGGGACCGGGGTCCGG + Intergenic
1176952537 21:15064539-15064561 CTCGCGGGGGGCCGGGGCGGCGG - Intronic
1178327854 21:31659950-31659972 CACGGGCCGGGACCGGGCGCTGG - Intronic
1178327919 21:31660110-31660132 CGCGGGCCGGGGAGGGGCGGGGG + Intronic
1178493804 21:33070763-33070785 CGCGCGCTGGGCGAGGGCGCCGG + Exonic
1178950327 21:36980611-36980633 CGCGCGGCCGCCCGGGGCTCTGG - Intronic
1179150689 21:38806031-38806053 TGCGCGCCGGGCGAGGGCGAGGG - Exonic
1179445234 21:41426187-41426209 CGCGGGGCGGGGCTGGGCGCGGG + Intronic
1179451808 21:41473287-41473309 CGCGGGCCGGGTGGGGGCTCAGG - Intronic
1179511854 21:41878905-41878927 CCCGCGCTGGGCCTGGCCGCGGG + Intronic
1179511970 21:41879227-41879249 CGCACGCCGGGGCGGGCGGCGGG + Intronic
1179522471 21:41954022-41954044 CGCGGGGCGGGGCGGGGCGGGGG + Intergenic
1179675007 21:42975035-42975057 CGCGCCCCGGCGCGGGGCGGGGG + Intronic
1179675038 21:42975105-42975127 CGCGCGGCGGGGCGGGGCCGGGG + Intronic
1179742671 21:43426908-43426930 CGGGCGCCGGGCCGGGGCTCGGG - Intronic
1179968052 21:44818171-44818193 CGCAGGCCGGGCCGCGGCTCTGG + Intronic
1180110329 21:45644283-45644305 AGGGCGGCGGGGCGGGGCGCGGG + Intronic
1180154823 21:45972727-45972749 CGGGCCCCGGCCCGGGGTGCGGG + Intergenic
1180615092 22:17121296-17121318 GGCGAGCCGGGCCGGGCGGCAGG + Intronic
1180744524 22:18078454-18078476 CGCGGTCCCGGCCCGGGCGCCGG + Exonic
1180960101 22:19758679-19758701 CCTGCGCCCGGCCGGTGCGCAGG + Intronic
1181026653 22:20131222-20131244 ATCGGGCAGGGCCGGGGCGCCGG + Intronic
1181030987 22:20148830-20148852 CGCGCGGGGGGCCTGGGGGCTGG + Intronic
1181082832 22:20425730-20425752 CGAGCGCGGGGCCGCGGCCCCGG - Exonic
1181085523 22:20437770-20437792 CGCGGGGCGGGCACGGGCGCGGG + Exonic
1181256843 22:21568146-21568168 CGGGCTCCGGGCAGGGGCTCCGG - Intronic
1181269854 22:21652619-21652641 CGCGGGCCGAGTCAGGGCGCAGG + Intronic
1181532119 22:23522728-23522750 CGGGGGCCGGGCTGGGGCGCGGG + Intergenic
1181631884 22:24155948-24155970 GGCGCGGCCGGACGGGGCGCCGG - Intronic
1181670543 22:24423829-24423851 CGCGCAGCGGGGCGGGGCGGGGG + Intronic
1182355341 22:29720242-29720264 GGCCCGGCGGCCCGGGGCGCGGG + Exonic
1182547551 22:31084871-31084893 CGGGGGCCGGGCCGGCGCGCGGG - Intronic
1182903901 22:33920597-33920619 CTCGCCCCGGCCTGGGGCGCGGG + Intronic
1183093669 22:35540236-35540258 CGCACGCCCGGCCTGGCCGCAGG - Intergenic
1183484365 22:38081430-38081452 CGCGGGCCCGGCCCGGGCGGCGG + Exonic
1183545895 22:38454836-38454858 CGCGCGCGGCGCCGGGCAGCCGG + Intronic
1183605964 22:38866856-38866878 CGGGCAGGGGGCCGGGGCGCTGG - Exonic
1183720134 22:39557777-39557799 GGCGCTCCGGGCCGGGGCGGGGG - Intergenic
1183966725 22:41446778-41446800 CTCACTTCGGGCCGGGGCGCGGG - Exonic
1184034109 22:41910491-41910513 CGCGGGCCGCGCGGGGGCCCCGG + Exonic
1184046761 22:41976880-41976902 GGCGCGGCGGCGCGGGGCGCAGG + Exonic
1184593913 22:45502990-45503012 AGCGCGCCGCGCCGTCGCGCCGG + Exonic
1184680795 22:46071344-46071366 CGCGCGCCGTCCCGGGGTGGGGG + Intronic
1185037927 22:48489446-48489468 GGCGCGGTGGGCCGGGGCCCGGG + Exonic
1185055277 22:48575903-48575925 CTCGCTCCGGCCCGGGGCTCAGG - Intronic
1185088060 22:48751312-48751334 GTCGCGCCGGGCAGAGGCGCAGG + Intronic
1185229114 22:49670378-49670400 CGAGCGCAGCGCCGGGGGGCCGG + Intergenic
1185272697 22:49936097-49936119 GGAGCGCGGGGCCGGGGCGGCGG - Intergenic
1185313802 22:50170400-50170422 GGCGGGCCGGGCCGGGGCGGCGG - Intergenic
1185333363 22:50261357-50261379 CGCGGGCCGGGCGGGGCGGCCGG - Intronic
1185335769 22:50270327-50270349 CGGGCGCGGGCGCGGGGCGCGGG - Exonic
1203253870 22_KI270733v1_random:129780-129802 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1203254033 22_KI270733v1_random:130327-130349 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1203254490 22_KI270733v1_random:131677-131699 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
1203255345 22_KI270733v1_random:135056-135078 CGCGCGCCGGGACCGGGGTCCGG + Intergenic
1203261926 22_KI270733v1_random:174859-174881 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1203262089 22_KI270733v1_random:175406-175428 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1203262546 22_KI270733v1_random:176756-176778 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
949987803 3:9553622-9553644 CGCGCGTCCGGCCTGGGCGCGGG - Intronic
950193410 3:10993014-10993036 CGCGAGCCGGGCCGGGTGGGGGG + Intronic
950518067 3:13480282-13480304 GGCGGGGCGGGGCGGGGCGCGGG - Exonic
950710578 3:14810636-14810658 GGGCCGCCGGGCGGGGGCGCGGG - Intergenic
950940338 3:16884962-16884984 CGCGCGGCGGCCCGAGGCGGCGG + Intronic
952867233 3:37862129-37862151 AGCGCGCGGGGGCGCGGCGCGGG - Intronic
952929296 3:38347060-38347082 CGCGCGCAGGGCAGGGGCGCGGG - Intronic
953485104 3:43287019-43287041 CCCGCTCCGGGGCGGGGCGCGGG - Intronic
954113131 3:48446891-48446913 GGCGGGCCGGGGCGAGGCGCCGG - Exonic
954405025 3:50340850-50340872 CGCGGGCCGGGCGGGGCCACAGG + Intronic
954702001 3:52455475-52455497 CACGCGCGGGGGCGGGGCGAGGG + Intronic
954778813 3:53045153-53045175 TGCCCGGCGGGCCGCGGCGCGGG + Intronic
955368799 3:58333162-58333184 CGCGGGCCGGGCAGGGTCGTCGG + Intronic
956605004 3:71065073-71065095 GGCGCGCGGGCGCGGGGCGCGGG - Intronic
956675037 3:71725325-71725347 CGCGCCCCCCGCCGGGGCCCGGG - Exonic
956675070 3:71725438-71725460 CGCGGGGCGGGGCGGGGCGGGGG - Intronic
960223772 3:115146996-115147018 GGCGGGGCGGGGCGGGGCGCGGG + Intronic
961202581 3:125056165-125056187 CGCGCGGCGGGCCCGGAGGCGGG + Intergenic
961377391 3:126475911-126475933 CGCACACCTGGGCGGGGCGCGGG - Exonic
961446422 3:126983612-126983634 GGCGGGCCCGGCCGGGGGGCGGG - Intergenic
961545340 3:127629295-127629317 TGCGCTCCGGGCCCGAGCGCGGG + Intronic
961551497 3:127672714-127672736 CGCCCGCGGGGCCGGGGTTCAGG - Exonic
962322984 3:134406746-134406768 GGGGCGCCGGGCAGGTGCGCGGG + Intergenic
963605596 3:147409922-147409944 GGCGCGGCGCGCCCGGGCGCTGG - Exonic
963904711 3:150763538-150763560 GGCGGGCAGGGGCGGGGCGCGGG + Intergenic
964358481 3:155871011-155871033 CGCGTGGCTGCCCGGGGCGCAGG - Intronic
964720424 3:159763964-159763986 GCCGGGCCGGGCCGGGGCGGGGG + Intronic
966181873 3:177196492-177196514 CGCGTCCGGGGCGGGGGCGCCGG - Intronic
966684834 3:182682737-182682759 CGCGCGCCGGCCCGGGAGCCCGG + Intergenic
966696232 3:182793400-182793422 CCGGGGGCGGGCCGGGGCGCCGG + Intergenic
966743461 3:183254291-183254313 CGCGGTCCGGGCCAGGGCGGCGG - Intronic
966982726 3:185153029-185153051 CGCGCGCCGCGCCGGAGGGAGGG - Intergenic
967054946 3:185823763-185823785 CTCCCGCCGGGCCGGGGTTCGGG + Intronic
968092808 3:195909096-195909118 CGAGGCCCGGGCCGGGGTGCAGG - Intronic
968479173 4:826234-826256 CGGGCGCCGGGCGGGGGCGGGGG + Intergenic
968506444 4:973357-973379 CGCGCCCGGGGCCGGGGCCGGGG - Exonic
968616318 4:1579249-1579271 CGCGGGCGGGGCCGGGGGCCGGG - Intergenic
968659585 4:1793561-1793583 AGCGGGCCGGGCCGGGGCGCGGG + Intronic
968729170 4:2261661-2261683 CACGCTCCGGGCGGGGGCGGGGG + Intronic
968729322 4:2262191-2262213 CGCGCCCCGGGGGCGGGCGCCGG + Exonic
968729424 4:2262612-2262634 GCCGGGCCGGGCCGGGCCGCCGG + Intergenic
968756427 4:2418475-2418497 CGGGCGGCGGGCAGGTGCGCGGG + Exonic
968879876 4:3293286-3293308 CCCGCGCCGGGCCCGGGACCAGG - Intronic
968879892 4:3293303-3293325 CGCGGGGCGGGGCGGGGCGGGGG + Intronic
968965119 4:3765837-3765859 CGCGGGGCGGGGCGGGCCGCGGG - Intergenic
968965204 4:3766120-3766142 GGCTCGGCGCGCCGGGGCGCCGG - Intergenic
969240378 4:5893116-5893138 CGCGCGCCGGGGCGGGGCCGGGG + Intergenic
969912156 4:10457056-10457078 CGCGCGCCAAGCCGCGGCCCGGG + Intronic
971294492 4:25376949-25376971 CGCGCGCCGGACCCAGGTGCTGG - Intergenic
972162585 4:36244517-36244539 CGCCCGCGGGGGCGGGGAGCAGG + Intergenic
972960682 4:44448581-44448603 CACGCGGAGGGCTGGGGCGCGGG - Exonic
973137312 4:46724415-46724437 CGCTCGCTGGGCCGCGGCGGCGG + Intergenic
973774795 4:54233169-54233191 AGCGCGGCGCGCAGGGGCGCAGG + Intronic
973894197 4:55395986-55396008 CGGGCGCCGAGCCGGGGCTGCGG + Exonic
975139162 4:70902594-70902616 CGGGCGGCGGGCGGGGGCCCAGG - Intronic
976431364 4:84966345-84966367 CGCGCCGCGGGCCGGGGGCCGGG + Exonic
978532547 4:109729836-109729858 CGCGCCCCGCGCCGCGGCTCGGG - Exonic
981033996 4:140152175-140152197 CGCGCGCGGATGCGGGGCGCGGG - Intronic
983649703 4:170026200-170026222 CCCCCGGCGGGCCGGGGCGGAGG - Intronic
984462874 4:180058700-180058722 GGCGCTCCGGGCGGGGGCGCGGG - Intergenic
984639354 4:182144802-182144824 CTAGTGCCGGGCCGCGGCGCCGG + Intronic
984667997 4:182448829-182448851 CGGCGGCCGAGCCGGGGCGCTGG + Intronic
984823505 4:183905219-183905241 CGCCGCCCGGGCCTGGGCGCTGG - Intronic
985068423 4:186144919-186144941 CGCGCGGCGGGCGCGGGCGCGGG + Exonic
985129093 4:186723874-186723896 GGCGGGCGGGGCCGGGGCGGAGG - Intronic
985423565 4:189807209-189807231 GGCGGGCCGGCGCGGGGCGCGGG - Intergenic
985493334 5:191687-191709 CGCGCGCGGTGCTGGGGCGCTGG + Exonic
985537509 5:473406-473428 GGCGCGCGGAGCCCGGGCGCTGG + Intronic
985611604 5:892561-892583 CGCGCGGCGGGCGGGGTCCCGGG - Intronic
985784466 5:1886710-1886732 CGCGGGCCGGCGCGGGGCGGGGG - Intronic
985894982 5:2743521-2743543 CGGGCGCCGGGCCGCGGAGCCGG + Intergenic
985896314 5:2751629-2751651 CGCGCGCCAGGCCGGCGGTCGGG + Exonic
986330420 5:6713329-6713351 CGGTCGCCGGGCCGTGTCGCCGG - Intergenic
986721550 5:10564222-10564244 GGCGGGGCGGGGCGGGGCGCGGG - Intergenic
986721609 5:10564429-10564451 CGGGCCGGGGGCCGGGGCGCGGG - Intronic
987082818 5:14441040-14441062 CGCGCGCTGGGCCGGGCCGTGGG + Intronic
988547689 5:32173934-32173956 CGGGCGGCGGGCGGCGGCGCCGG - Exonic
989592164 5:43121647-43121669 CGCGGGCCGGACCGGGTCCCGGG + Exonic
990545527 5:56816630-56816652 CGCGGGCTGGGCCCGGACGCAGG + Intronic
991587527 5:68215689-68215711 GGCGCGCGGGGCCGGGCCGGAGG + Intergenic
992105895 5:73448602-73448624 CTCGCGCCCGGCCCGGGCGGAGG + Intergenic
992124364 5:73626020-73626042 CGCGAGCCGGGCCGGGAGGTGGG + Intergenic
992837406 5:80654603-80654625 CGTGCGCCGGGGCGGGGGGGCGG - Exonic
993504652 5:88694339-88694361 CCAGCGCAGAGCCGGGGCGCGGG - Intergenic
995724363 5:115169120-115169142 CGGGGGGCGGGCCGGGGCCCCGG - Intronic
997265006 5:132490365-132490387 CGAGCCGCGGGCCGCGGCGCGGG - Intronic
997319050 5:132963213-132963235 CCAGGGCCGGGCCGGGCCGCGGG - Intronic
997704053 5:135930427-135930449 CGCGGGCCGGGCCAAGGTGCTGG - Intronic
998076299 5:139239468-139239490 ACCGCGCCCGGCCGGGGCGAGGG - Intronic
998166670 5:139848281-139848303 CGCGCGCGCGGCCGCGGCGGCGG + Exonic
998424200 5:142013029-142013051 CCCGCGCGGGGCCGGGCCGCCGG - Intronic
1000014580 5:157266130-157266152 AGGGCCCCGCGCCGGGGCGCAGG - Exonic
1000071356 5:157743796-157743818 CGCGGGCTGGGCGGGCGCGCGGG - Exonic
1000907357 5:166978843-166978865 CGCGCACCGGCCCAGGCCGCCGG - Intergenic
1001342846 5:170862654-170862676 CCCGGGCCGGGCGCGGGCGCGGG + Intronic
1001825602 5:174742787-174742809 GGCGGGCCGGGGGGGGGCGCTGG - Intergenic
1002006539 5:176238777-176238799 AGCGCGGCGGGCCGGGGCAGGGG + Intronic
1002046319 5:176543452-176543474 TTCGCGCGGGGCCGGGGCGGGGG - Intronic
1002055705 5:176596950-176596972 CGGGCGGCGGGCGGCGGCGCGGG + Exonic
1002139853 5:177132364-177132386 TGCGCGCCGGGCTGGGGGCCGGG - Intergenic
1002180089 5:177426806-177426828 GGCCCGCCGGGCCGCGCCGCCGG - Intronic
1002219839 5:177671859-177671881 AGCGCGGCGGGCCGGGGCAGGGG - Intergenic
1002345296 5:178544375-178544397 CAGGCGCAGGGCCGGGGAGCTGG + Intronic
1002512752 5:179733366-179733388 CAGGCGCGGGGCCGGGGCGGCGG - Exonic
1002522110 5:179797842-179797864 CGCCCGCCGGGCCGCGGAGGAGG - Exonic
1002771235 6:292290-292312 CGGGAGCCGGGCAGGGGCACCGG - Intronic
1002926775 6:1609700-1609722 CGGGCGCAGGGCCGGGGCCCGGG + Intergenic
1002927757 6:1614697-1614719 CGCGGGCTGGGTCGGGGTGCCGG + Intergenic
1003552279 6:7109296-7109318 CGCGAGCGGGGAGGGGGCGCGGG - Intronic
1003661199 6:8064159-8064181 CGCGCGCCAGCCCGGGACCCGGG + Intronic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1003942663 6:11044340-11044362 CGCGCGCCGGGCGTGGGTGTGGG - Intergenic
1003942721 6:11044488-11044510 GGCGCGCGGGGGAGGGGCGCAGG + Intergenic
1004561802 6:16759962-16759984 CGCGCGCCGGGCGGGGGGCGAGG - Intronic
1004627928 6:17393939-17393961 CGGGCGCGGGGCGCGGGCGCGGG + Intronic
1004690232 6:17987301-17987323 CGCGGCCGGGGCCGGGGGGCCGG - Intronic
1004709281 6:18155139-18155161 CGCGGGCGGAGGCGGGGCGCGGG - Intergenic
1004709288 6:18155156-18155178 CGCGGGCGGAGGCGGGGCGCGGG - Intergenic
1005048524 6:21664476-21664498 CACGCGCAGGGCCGCGGCTCTGG - Intergenic
1005859103 6:29887873-29887895 GGCCCGCCCGGCGGGGGCGCAGG + Intergenic
1006941361 6:37753964-37753986 CGCGGGCCTGGCCAGGGAGCGGG + Intergenic
1007432765 6:41786292-41786314 CTCGAGCTGGGCCGGGGCACTGG + Exonic
1007625455 6:43243827-43243849 CGCCCGCTGGGCTGGGACGCTGG + Intronic
1007785267 6:44276194-44276216 CGGGCCCCGGGCCGGCCCGCGGG - Exonic
1010781220 6:79947602-79947624 CGCGCGCGGGGGCGGGGGGCCGG + Intergenic
1012548356 6:100446690-100446712 CCCGCGCGGGGCCTGGGCGCCGG + Intronic
1013117569 6:107114776-107114798 CGCGCGCCGCGCGGGGGCGGGGG - Intronic
1013422358 6:109978411-109978433 TGGGCGCCGAGGCGGGGCGCCGG - Exonic
1013792682 6:113855123-113855145 CGCGCGAGGGGGCGGGGTGCGGG - Intergenic
1014098295 6:117482958-117482980 GGCGGGCCGGGCCGGGCCGAGGG + Intronic
1014137548 6:117907209-117907231 GGAGAGCCGGGCGGGGGCGCCGG - Intergenic
1016340908 6:143060799-143060821 CGCGGGGCGGGGCGGGGCGGGGG - Intronic
1016949619 6:149566778-149566800 CGCGCGCCGGCTTGGGCCGCCGG - Intronic
1019114820 6:169751630-169751652 CGCGCGCCGCAGCGGGGCACCGG + Exonic
1019279277 7:192182-192204 GGAGCGCGGGGCCGGGGCCCAGG - Intergenic
1019279484 7:192807-192829 GGCGCGACGGGCCTGGGCGGTGG - Intergenic
1019343426 7:518904-518926 CCGGCGCAGGGACGGGGCGCGGG + Intronic
1019437083 7:1027986-1028008 GGGGCGCAGGGCCGGGCCGCGGG - Intronic
1019474383 7:1236852-1236874 CGAGGGCCGGGCCTGGGCGACGG - Exonic
1019630495 7:2046384-2046406 CGGGCGCCGGGCCTGGGAGGAGG - Intronic
1020105492 7:5420586-5420608 CTCGCGCCGAGCCGGGTCCCTGG - Intronic
1020106988 7:5426790-5426812 AGGGCGCGGGGCCGGGGAGCGGG - Intergenic
1020238528 7:6374707-6374729 CGCTCGCTGGGCCGCGGCGGCGG - Exonic
1020418263 7:7969635-7969657 CGCGGGCCGCGCCGGGCCCCGGG - Exonic
1021716837 7:23469250-23469272 CGCTCTCCGGGCCCTGGCGCGGG - Intronic
1021884500 7:25125402-25125424 CGCGCGCAGGTCCTTGGCGCAGG - Intergenic
1022400121 7:30028627-30028649 CCCACACCGGGCCCGGGCGCCGG + Exonic
1022714977 7:32891356-32891378 CGCGGGCGGGGGAGGGGCGCGGG - Intronic
1022785362 7:33632481-33632503 CGCGAGCGGGGCGAGGGCGCCGG - Intergenic
1023881786 7:44325107-44325129 CGGCTGCCGGGCCGGGGCTCCGG - Intronic
1024043790 7:45574370-45574392 CGCGCTCCGGGCGCGCGCGCGGG + Intronic
1024043835 7:45574485-45574507 CCCTCGCCGGCCCGGGGCGCCGG - Intronic
1024965466 7:55019441-55019463 CGGGCGCCGAGCCGGTGCGCCGG - Intronic
1025033043 7:55572565-55572587 CGCGCCCCAGGCCGGGCCTCGGG - Intronic
1026458888 7:70596164-70596186 CGCGGGCCGGGGCGGGGCTGGGG + Intronic
1026765133 7:73155347-73155369 AGCGCGCGGGGACGCGGCGCCGG + Intergenic
1027041606 7:74965102-74965124 AGCGCGCGGGGACGCGGCGCCGG + Intronic
1027059364 7:75073466-75073488 CGGGCGCCGGCGCGGGGCCCGGG + Exonic
1027082036 7:75237267-75237289 AGCGCGCGGGGACGCGGCGCCGG - Intergenic
1029363039 7:100100870-100100892 CGCGCGCCTGGGGAGGGCGCGGG + Intronic
1029367885 7:100127857-100127879 CGAGCCCCGGGCCCAGGCGCAGG - Exonic
1029461080 7:100694149-100694171 CGCGCGGCGGGCGGGGGCCGGGG + Intergenic
1029537247 7:101163883-101163905 CACGCGGCAGGCCGCGGCGCAGG - Exonic
1030033345 7:105388546-105388568 CGCCCGCCGGCCCGGGGACCCGG + Intronic
1030215994 7:107044598-107044620 CGCGCACCGCGGCGGGGCGGGGG + Intergenic
1031008402 7:116499588-116499610 GGGGCGCCGGGGCGGGGCTCGGG + Exonic
1031886599 7:127251698-127251720 CCCGCGCGGGGCGTGGGCGCGGG - Intronic
1031919129 7:127588583-127588605 CGCGGCCCGGACCGGGGCGCCGG + Intronic
1032074582 7:128830386-128830408 GGCGGGCTGGGCCGGGGCGGGGG - Exonic
1032174521 7:129612201-129612223 AGTGCGCCGGGCCCGGGAGCGGG + Intronic
1032306122 7:130733804-130733826 CCCGCGCCGGGGCTGGGGGCGGG + Exonic
1033253286 7:139778049-139778071 CGGGGGCGGGGGCGGGGCGCGGG + Intronic
1033654359 7:143362802-143362824 GGCGAGCCGAGCCGGGGCGGGGG - Intergenic
1033662055 7:143408875-143408897 GGCGGGCCGGGCGGGGGCGGGGG + Exonic
1033756959 7:144403780-144403802 CACGGGCCGGGCCGGGCCGGGGG + Intronic
1034147424 7:148884829-148884851 CGCGCGCGGAGCCGAGGCCCGGG + Intergenic
1034228009 7:149497749-149497771 CGTCTGCCGGGCCGCGGCGCCGG - Exonic
1034284304 7:149874207-149874229 GGCGAGCCGGGCCAGGGGGCCGG - Intronic
1034475105 7:151277085-151277107 CGCGCTCCGGGCCGGGGTCCCGG - Intronic
1034618061 7:152436006-152436028 CGCGCGCAGGGGCCGGGCGGGGG + Intergenic
1034830695 7:154305117-154305139 TGGGCGCCGGGCCGGGAGGCGGG + Exonic
1035127168 7:156616842-156616864 CGCGGGCAGGAGCGGGGCGCGGG - Intergenic
1035637355 8:1156616-1156638 GGGGCGCTGGGCTGGGGCGCTGG - Intergenic
1035637361 8:1156629-1156651 GGGGCGCTGAGCCGGGGCGCTGG - Intergenic
1035747863 8:1974396-1974418 AGCGCGCGGGGCCAGGGCGGGGG + Intronic
1036787980 8:11700626-11700648 CCCCCGCTGGGCCTGGGCGCCGG - Intronic
1037116768 8:15237135-15237157 CCCGTGCCGGGCTGGGGCACAGG + Intronic
1037947743 8:22999762-22999784 CGGGCGGCGCGCAGGGGCGCCGG - Intronic
1038205051 8:25458158-25458180 GGCGCGGCGGGCCGGGGGTCGGG - Intronic
1038727677 8:30095659-30095681 CAAGCGCAGGGCCGGGGCGGGGG - Intronic
1038760979 8:30384336-30384358 CGCGCGCCGGGGAGGGGCAGCGG - Intergenic
1039554688 8:38467748-38467770 CGAGCGCAGGGAGGGGGCGCAGG + Exonic
1039903169 8:41767294-41767316 CCCGGCCGGGGCCGGGGCGCGGG - Intronic
1039936687 8:42051924-42051946 CGCGGTCCGGCCCGGGGCCCCGG - Exonic
1041045000 8:53880433-53880455 GGCGCCCCGGGCCGGGGAGAAGG + Intronic
1042903036 8:73746985-73747007 CGCGCGCCGGCCGGGCGTGCTGG - Intronic
1043502719 8:80873550-80873572 CGCGCCCCGGGCCGGGCCCCTGG + Intronic
1043502826 8:80873894-80873916 CGGGCGCCGGGGCCGGGCCCGGG + Intronic
1044306588 8:90646338-90646360 CGGGCGACGGGCAGGGGCCCAGG + Intronic
1045063532 8:98427192-98427214 CGCCCGGCGGGCCGGCGGGCGGG - Exonic
1045231466 8:100310361-100310383 AGCGCGCCGGGCAGTGGGGCCGG + Intronic
1045336159 8:101205769-101205791 CGCGCGACCAGCCAGGGCGCAGG - Intronic
1045510861 8:102810881-102810903 CGAGCGCCCGGCAGGGGCGGTGG - Intergenic
1047998474 8:130358252-130358274 CGCGCGCCAGGCCGGGCGGCGGG - Intronic
1048009279 8:130443346-130443368 AGGGCGCCGGGACGGGGCGCGGG - Intronic
1049194760 8:141308835-141308857 CGCGCCACGGGCAGGGGCGGAGG - Intergenic
1049218278 8:141417636-141417658 CGCGCACCGGGAGAGGGCGCCGG + Intronic
1049409124 8:142464666-142464688 CCGGCCCCGGGCCGGGCCGCCGG + Exonic
1049419468 8:142510555-142510577 CCCGCGCGGGCCGGGGGCGCGGG + Intronic
1049419663 8:142511100-142511122 GGGGCGCCGGGCAGGGGCGCGGG + Intronic
1049541510 8:143211239-143211261 CGGTAGCCGGGGCGGGGCGCGGG + Intergenic
1049583458 8:143422790-143422812 GGAGCGCCGGGCAGGGGGGCGGG - Intronic
1049645334 8:143733519-143733541 CGTGCGCGGGGCCGGGGTGGCGG - Intronic
1049659933 8:143815413-143815435 CGGGCTCGGGGCCGGGGGGCGGG + Intergenic
1049789511 8:144466351-144466373 CGGGCGCCGAGTCTGGGCGCGGG + Exonic
1053128954 9:35604868-35604890 GGCAGGCTGGGCCGGGGCGCAGG + Intergenic
1053157594 9:35791664-35791686 CGCGCGCGGGGCCCAGGCGGGGG + Intergenic
1054731337 9:68705283-68705305 CGCCCGCCGGGCTCGGGCGCGGG - Intergenic
1056732474 9:89178092-89178114 GGCGCTCATGGCCGGGGCGCGGG + Exonic
1056992339 9:91423711-91423733 CTCGGGCCGGGCCGGGCCTCCGG + Exonic
1057054450 9:91949994-91950016 AGAGCTTCGGGCCGGGGCGCGGG + Exonic
1057432234 9:95004949-95004971 CGGGCGCGGGGCCTGGGCGGCGG - Intronic
1057773351 9:97985072-97985094 CCCGCGCCGGTCCGCGGCGGGGG - Intronic
1058176023 9:101737693-101737715 CGTGCGCCCGGCGAGGGCGCCGG + Exonic
1058885743 9:109320372-109320394 CGCGGGGCGCGGCGGGGCGCGGG - Exonic
1058908275 9:109498418-109498440 GGCGCGCCAGCCCGGGGCGGGGG - Intergenic
1059061320 9:111037978-111038000 CGCGCTGTGGGCCGCGGCGCGGG - Exonic
1059414758 9:114155865-114155887 GGCGCGGCGGGGCGGGGGGCTGG + Exonic
1060468721 9:123930116-123930138 CGCGCGCCGGGCACGCGCGCCGG - Intronic
1060713027 9:125889745-125889767 GGCGCGCCGCGGCGGGGAGCGGG + Intronic
1060979862 9:127785831-127785853 GGCGCGGGGAGCCGGGGCGCCGG - Intronic
1061038735 9:128127728-128127750 CGCGCGCCCGCCCGCGGCGCCGG - Exonic
1061127966 9:128688967-128688989 CGCGCGGCAGGCCGGTGGGCGGG - Intronic
1061158938 9:128882320-128882342 GGCGCCCCGGGCCGGGCAGCTGG - Intronic
1061248417 9:129413376-129413398 CGGGGGCCGGGGCGGGGGGCAGG - Intergenic
1061293715 9:129666169-129666191 CGGGGCCGGGGCCGGGGCGCGGG + Intronic
1061366030 9:130172789-130172811 AGCGCGCGGGTCCGGGGGGCGGG - Intronic
1061382383 9:130266146-130266168 CGCCCGGCGGGCGGGGGTGCGGG - Intergenic
1061415451 9:130444846-130444868 CGGGGGCCGGGCCCGGGGGCGGG + Intergenic
1061453418 9:130681220-130681242 CGCGGGGCGGGGCGGGGCGGGGG - Intronic
1062314774 9:135961272-135961294 CGGGAGCCGGGGCGGGGCGGCGG - Exonic
1062414279 9:136439867-136439889 TGTGGGCGGGGCCGGGGCGCGGG - Intergenic
1062556082 9:137114056-137114078 CGGGTGCCGGGCGGGGTCGCGGG - Intronic
1062556099 9:137114097-137114119 CGGGTGCCGGGCGGGGTCGCGGG - Intronic
1062556116 9:137114138-137114160 CGGGTGCCGGGCGGGGTCGCGGG - Intronic
1062574668 9:137200599-137200621 GCCGCGCTGGGCGGGGGCGCGGG - Exonic
1062596267 9:137301310-137301332 CGCGGGTGGGGGCGGGGCGCGGG - Exonic
1062596353 9:137301548-137301570 CGGGCGCAGGGCCGGGGTCCGGG + Exonic
1062653454 9:137590175-137590197 GGCGAGACGGGCCGGGTCGCGGG + Intronic
1062658962 9:137618577-137618599 CCCGCGCCAGGCCGCGGCCCAGG + Exonic
1062659157 9:137619240-137619262 AGCGCGCCCGGCGGGAGCGCGGG - Intronic
1203470270 Un_GL000220v1:112924-112946 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1203470434 Un_GL000220v1:113471-113493 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1203470891 Un_GL000220v1:114821-114843 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
1203471743 Un_GL000220v1:118193-118215 CGCGCGCCGGGACCGGGGTCCGG + Intergenic
1203478091 Un_GL000220v1:156896-156918 CGCGCCCGTGGCCGCGGCGCCGG + Intergenic
1203478255 Un_GL000220v1:157443-157465 CCCGCCCCGCGGCGGGGCGCGGG + Intergenic
1203478712 Un_GL000220v1:158793-158815 CGCCCGCCGCGCCGGGGAGGTGG + Intergenic
1185471532 X:386724-386746 CCCGGGGCGGGGCGGGGCGCGGG - Intronic
1185505571 X:630535-630557 CGCGCGCAGGAGGGGGGCGCAGG - Exonic
1185894158 X:3843488-3843510 CGCACTCAGGTCCGGGGCGCCGG + Exonic
1185899277 X:3881912-3881934 CGCACTCAGGTCCGGGGCGCCGG + Intergenic
1185904394 X:3920341-3920363 CGCACTCAGGTCCGGGGCGCCGG + Intergenic
1186466390 X:9786839-9786861 CACCTGCCGGGCCTGGGCGCCGG + Intronic
1189354230 X:40299095-40299117 CCCGGGCGGGGGCGGGGCGCGGG + Intergenic
1190881548 X:54495680-54495702 CCCGCGCGGGGCCGGGGCCGGGG - Exonic
1192561693 X:72131727-72131749 CGCGCCCTGGGCCGAGCCGCCGG - Exonic
1193085857 X:77447615-77447637 CGCGGGCCGAGCCGGGGCCACGG - Intergenic
1195625106 X:106999566-106999588 CGCGGGGCGGGCCGGGGCTGGGG - Intronic
1195702674 X:107716644-107716666 CGCCTCCCGAGCCGGGGCGCCGG - Intronic
1198276314 X:135098318-135098340 CCCGCCCCCGGCCGGGTCGCGGG - Intergenic
1198310193 X:135422422-135422444 CCCGCCCCCGGCCGGGTCGCCGG + Intergenic
1198312719 X:135437016-135437038 CGCGTCCCGGGCAGGGGAGCCGG - Intergenic
1199612664 X:149631488-149631510 CGCGCTGCGGGCTCGGGCGCGGG - Intronic
1199772678 X:150984263-150984285 TGCGCCCCGCGCCGGGGGGCGGG + Intronic
1200047697 X:153411456-153411478 AGCGGGCGGGGCCGGGGCGGCGG - Intergenic
1200093584 X:153647143-153647165 GGCGGGCCGGGGCGGGGCTCCGG - Intronic
1200107743 X:153724299-153724321 CGCGCGCCGGGCTGGGCTCCGGG - Intronic
1200146192 X:153927615-153927637 CGCGCTGTGGGCAGGGGCGCAGG - Intronic
1200147731 X:153935157-153935179 CGCGGGGCGGGCCTGGGGGCGGG + Exonic
1200173657 X:154097316-154097338 CGCCCGCGGGGCCGGGGGCCGGG + Intronic
1200224855 X:154411795-154411817 CACAGGCCGGCCCGGGGCGCTGG + Exonic
1200233557 X:154458023-154458045 CGGGCGGGGAGCCGGGGCGCGGG + Intergenic