ID: 1122975442

View in Genome Browser
Species Human (GRCh38)
Location 14:105168918-105168940
Sequence GGCCCGGCGCGCGCCCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975436_1122975442 -9 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 216
1122975429_1122975442 22 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 216
1122975430_1122975442 21 Left 1122975430 14:105168874-105168896 CCCAGGCTTTAAAGGCGGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 216
1122975431_1122975442 20 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975442 14:105168918-105168940 GGCCCGGCGCGCGCCCCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975442 Original CRISPR GGCCCGGCGCGCGCCCCCCA GGG Intergenic