ID: 1122975445

View in Genome Browser
Species Human (GRCh38)
Location 14:105168925-105168947
Sequence CGCGCGCCCCCCAGGGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975437_1122975445 -6 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284
1122975429_1122975445 29 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284
1122975436_1122975445 -2 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284
1122975431_1122975445 27 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284
1122975430_1122975445 28 Left 1122975430 14:105168874-105168896 CCCAGGCTTTAAAGGCGGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1122975445 14:105168925-105168947 CGCGCGCCCCCCAGGGCGCCCGG 0: 1
1: 0
2: 2
3: 24
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975445 Original CRISPR CGCGCGCCCCCCAGGGCGCC CGG Intergenic