ID: 1122975446

View in Genome Browser
Species Human (GRCh38)
Location 14:105168926-105168948
Sequence GCGCGCCCCCCAGGGCGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975436_1122975446 -1 Left 1122975436 14:105168904-105168926 CCTGCCAGCGCCCCGGCCCGGCG 0: 1
1: 2
2: 6
3: 57
4: 546
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1122975430_1122975446 29 Left 1122975430 14:105168874-105168896 CCCAGGCTTTAAAGGCGGTGGAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1122975429_1122975446 30 Left 1122975429 14:105168873-105168895 CCCCAGGCTTTAAAGGCGGTGGA 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1122975437_1122975446 -5 Left 1122975437 14:105168908-105168930 CCAGCGCCCCGGCCCGGCGCGCG 0: 2
1: 0
2: 14
3: 88
4: 765
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301
1122975431_1122975446 28 Left 1122975431 14:105168875-105168897 CCAGGCTTTAAAGGCGGTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1122975446 14:105168926-105168948 GCGCGCCCCCCAGGGCGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975446 Original CRISPR GCGCGCCCCCCAGGGCGCCC GGG Intergenic