ID: 1122975802

View in Genome Browser
Species Human (GRCh38)
Location 14:105170261-105170283
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975802_1122975808 10 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG No data
1122975802_1122975815 24 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975815 14:105170308-105170330 TTGGCCTGGGGGCAGGTACTCGG No data
1122975802_1122975811 12 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975811 14:105170296-105170318 CTCTCCTGTGCTTTGGCCTGGGG No data
1122975802_1122975806 5 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975806 14:105170289-105170311 ATGCCACCTCTCCTGTGCTTTGG No data
1122975802_1122975816 25 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975802_1122975814 17 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975814 14:105170301-105170323 CTGTGCTTTGGCCTGGGGGCAGG No data
1122975802_1122975812 13 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975812 14:105170297-105170319 TCTCCTGTGCTTTGGCCTGGGGG No data
1122975802_1122975810 11 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975810 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975802 Original CRISPR CAGGGAGCCCCTCCCCCCGT AGG (reversed) Intergenic