ID: 1122975805

View in Genome Browser
Species Human (GRCh38)
Location 14:105170280-105170302
Sequence AGGAGAGGTGGCATCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975805_1122975815 5 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975815 14:105170308-105170330 TTGGCCTGGGGGCAGGTACTCGG No data
1122975805_1122975816 6 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975805_1122975808 -9 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG No data
1122975805_1122975818 19 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975818 14:105170322-105170344 GGTACTCGGGTACTCGAGAGAGG No data
1122975805_1122975820 30 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975820 14:105170333-105170355 ACTCGAGAGAGGGAAGCCCCAGG No data
1122975805_1122975812 -6 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975812 14:105170297-105170319 TCTCCTGTGCTTTGGCCTGGGGG No data
1122975805_1122975819 20 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975819 14:105170323-105170345 GTACTCGGGTACTCGAGAGAGGG No data
1122975805_1122975811 -7 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975811 14:105170296-105170318 CTCTCCTGTGCTTTGGCCTGGGG No data
1122975805_1122975814 -2 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975814 14:105170301-105170323 CTGTGCTTTGGCCTGGGGGCAGG No data
1122975805_1122975810 -8 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975810 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975805 Original CRISPR AGGAGAGGTGGCATCTCCAC AGG (reversed) Intergenic