ID: 1122975806

View in Genome Browser
Species Human (GRCh38)
Location 14:105170289-105170311
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975802_1122975806 5 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975806 14:105170289-105170311 ATGCCACCTCTCCTGTGCTTTGG No data
1122975801_1122975806 8 Left 1122975801 14:105170258-105170280 CCGCCTACGGGGGGAGGGGCTCC No data
Right 1122975806 14:105170289-105170311 ATGCCACCTCTCCTGTGCTTTGG No data
1122975792_1122975806 29 Left 1122975792 14:105170237-105170259 CCGGTGTGTGGGCGGTGATTACC No data
Right 1122975806 14:105170289-105170311 ATGCCACCTCTCCTGTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975806 Original CRISPR ATGCCACCTCTCCTGTGCTT TGG Intergenic