ID: 1122975807

View in Genome Browser
Species Human (GRCh38)
Location 14:105170292-105170314
Sequence AGGCCAAAGCACAGGAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975807_1122975815 -7 Left 1122975807 14:105170292-105170314 CCACCTCTCCTGTGCTTTGGCCT No data
Right 1122975815 14:105170308-105170330 TTGGCCTGGGGGCAGGTACTCGG No data
1122975807_1122975819 8 Left 1122975807 14:105170292-105170314 CCACCTCTCCTGTGCTTTGGCCT No data
Right 1122975819 14:105170323-105170345 GTACTCGGGTACTCGAGAGAGGG No data
1122975807_1122975820 18 Left 1122975807 14:105170292-105170314 CCACCTCTCCTGTGCTTTGGCCT No data
Right 1122975820 14:105170333-105170355 ACTCGAGAGAGGGAAGCCCCAGG No data
1122975807_1122975816 -6 Left 1122975807 14:105170292-105170314 CCACCTCTCCTGTGCTTTGGCCT No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975807_1122975818 7 Left 1122975807 14:105170292-105170314 CCACCTCTCCTGTGCTTTGGCCT No data
Right 1122975818 14:105170322-105170344 GGTACTCGGGTACTCGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975807 Original CRISPR AGGCCAAAGCACAGGAGAGG TGG (reversed) Intergenic