ID: 1122975808

View in Genome Browser
Species Human (GRCh38)
Location 14:105170294-105170316
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975805_1122975808 -9 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG No data
1122975802_1122975808 10 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG No data
1122975804_1122975808 -8 Left 1122975804 14:105170279-105170301 CCCTGTGGAGATGCCACCTCTCC No data
Right 1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG No data
1122975801_1122975808 13 Left 1122975801 14:105170258-105170280 CCGCCTACGGGGGGAGGGGCTCC No data
Right 1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975808 Original CRISPR ACCTCTCCTGTGCTTTGGCC TGG Intergenic