ID: 1122975809

View in Genome Browser
Species Human (GRCh38)
Location 14:105170295-105170317
Sequence CCCAGGCCAAAGCACAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975809_1122975819 5 Left 1122975809 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data
Right 1122975819 14:105170323-105170345 GTACTCGGGTACTCGAGAGAGGG No data
1122975809_1122975816 -9 Left 1122975809 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975809_1122975820 15 Left 1122975809 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data
Right 1122975820 14:105170333-105170355 ACTCGAGAGAGGGAAGCCCCAGG No data
1122975809_1122975818 4 Left 1122975809 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data
Right 1122975818 14:105170322-105170344 GGTACTCGGGTACTCGAGAGAGG No data
1122975809_1122975815 -10 Left 1122975809 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data
Right 1122975815 14:105170308-105170330 TTGGCCTGGGGGCAGGTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975809 Original CRISPR CCCAGGCCAAAGCACAGGAG AGG (reversed) Intergenic