ID: 1122975816

View in Genome Browser
Species Human (GRCh38)
Location 14:105170309-105170331
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122975802_1122975816 25 Left 1122975802 14:105170261-105170283 CCTACGGGGGGAGGGGCTCCCTG No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975807_1122975816 -6 Left 1122975807 14:105170292-105170314 CCACCTCTCCTGTGCTTTGGCCT No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975809_1122975816 -9 Left 1122975809 14:105170295-105170317 CCTCTCCTGTGCTTTGGCCTGGG No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975801_1122975816 28 Left 1122975801 14:105170258-105170280 CCGCCTACGGGGGGAGGGGCTCC No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975804_1122975816 7 Left 1122975804 14:105170279-105170301 CCCTGTGGAGATGCCACCTCTCC No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data
1122975805_1122975816 6 Left 1122975805 14:105170280-105170302 CCTGTGGAGATGCCACCTCTCCT No data
Right 1122975816 14:105170309-105170331 TGGCCTGGGGGCAGGTACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122975816 Original CRISPR TGGCCTGGGGGCAGGTACTC GGG Intergenic