ID: 1122976361

View in Genome Browser
Species Human (GRCh38)
Location 14:105172472-105172494
Sequence AGAGCCACTCCACAGGAGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976361_1122976367 1 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data
1122976361_1122976378 27 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976361_1122976365 -1 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976365 14:105172494-105172516 TAGCCCAGCCCCAGTCAGGGTGG No data
1122976361_1122976366 0 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976366 14:105172495-105172517 AGCCCAGCCCCAGTCAGGGTGGG No data
1122976361_1122976373 20 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data
1122976361_1122976364 -4 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976364 14:105172491-105172513 CTCTAGCCCAGCCCCAGTCAGGG No data
1122976361_1122976363 -5 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976363 14:105172490-105172512 GCTCTAGCCCAGCCCCAGTCAGG No data
1122976361_1122976376 26 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976361 Original CRISPR AGAGCCACTCCACAGGAGCC CGG (reversed) Intergenic
No off target data available for this crispr