ID: 1122976362

View in Genome Browser
Species Human (GRCh38)
Location 14:105172479-105172501
Sequence CTGGGCTAGAGCCACTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976362_1122976378 20 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976362_1122976366 -7 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976366 14:105172495-105172517 AGCCCAGCCCCAGTCAGGGTGGG No data
1122976362_1122976373 13 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data
1122976362_1122976365 -8 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976365 14:105172494-105172516 TAGCCCAGCCCCAGTCAGGGTGG No data
1122976362_1122976376 19 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976362_1122976367 -6 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976362 Original CRISPR CTGGGCTAGAGCCACTCCAC AGG (reversed) Intergenic
No off target data available for this crispr