ID: 1122976367

View in Genome Browser
Species Human (GRCh38)
Location 14:105172496-105172518
Sequence GCCCAGCCCCAGTCAGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976355_1122976367 24 Left 1122976355 14:105172449-105172471 CCCGACACAGGGCAGCTTTGGCT No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data
1122976362_1122976367 -6 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data
1122976352_1122976367 26 Left 1122976352 14:105172447-105172469 CCCCCGACACAGGGCAGCTTTGG No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data
1122976361_1122976367 1 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data
1122976354_1122976367 25 Left 1122976354 14:105172448-105172470 CCCCGACACAGGGCAGCTTTGGC No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data
1122976356_1122976367 23 Left 1122976356 14:105172450-105172472 CCGACACAGGGCAGCTTTGGCTC No data
Right 1122976367 14:105172496-105172518 GCCCAGCCCCAGTCAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976367 Original CRISPR GCCCAGCCCCAGTCAGGGTG GGG Intergenic