ID: 1122976369

View in Genome Browser
Species Human (GRCh38)
Location 14:105172498-105172520
Sequence GTCCCCACCCTGACTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976369_1122976378 1 Left 1122976369 14:105172498-105172520 CCAGCCCCAGTCAGGGTGGGGAC No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976369_1122976373 -6 Left 1122976369 14:105172498-105172520 CCAGCCCCAGTCAGGGTGGGGAC No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data
1122976369_1122976376 0 Left 1122976369 14:105172498-105172520 CCAGCCCCAGTCAGGGTGGGGAC No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976369 Original CRISPR GTCCCCACCCTGACTGGGGC TGG (reversed) Intergenic