ID: 1122976372

View in Genome Browser
Species Human (GRCh38)
Location 14:105172504-105172526
Sequence TGAGGGGTCCCCACCCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976372_1122976376 -6 Left 1122976372 14:105172504-105172526 CCAGTCAGGGTGGGGACCCCTCA No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976372_1122976378 -5 Left 1122976372 14:105172504-105172526 CCAGTCAGGGTGGGGACCCCTCA No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976372 Original CRISPR TGAGGGGTCCCCACCCTGAC TGG (reversed) Intergenic
No off target data available for this crispr