ID: 1122976373

View in Genome Browser
Species Human (GRCh38)
Location 14:105172515-105172537
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976361_1122976373 20 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data
1122976368_1122976373 -5 Left 1122976368 14:105172497-105172519 CCCAGCCCCAGTCAGGGTGGGGA No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data
1122976369_1122976373 -6 Left 1122976369 14:105172498-105172520 CCAGCCCCAGTCAGGGTGGGGAC No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data
1122976370_1122976373 -10 Left 1122976370 14:105172502-105172524 CCCCAGTCAGGGTGGGGACCCCT No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data
1122976362_1122976373 13 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976373 14:105172515-105172537 GGGGACCCCTCACTTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976373 Original CRISPR GGGGACCCCTCACTTGCCCC AGG Intergenic