ID: 1122976376

View in Genome Browser
Species Human (GRCh38)
Location 14:105172521-105172543
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976369_1122976376 0 Left 1122976369 14:105172498-105172520 CCAGCCCCAGTCAGGGTGGGGAC No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976372_1122976376 -6 Left 1122976372 14:105172504-105172526 CCAGTCAGGGTGGGGACCCCTCA No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976361_1122976376 26 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976362_1122976376 19 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976371_1122976376 -5 Left 1122976371 14:105172503-105172525 CCCAGTCAGGGTGGGGACCCCTC No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976370_1122976376 -4 Left 1122976370 14:105172502-105172524 CCCCAGTCAGGGTGGGGACCCCT No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data
1122976368_1122976376 1 Left 1122976368 14:105172497-105172519 CCCAGCCCCAGTCAGGGTGGGGA No data
Right 1122976376 14:105172521-105172543 CCCTCACTTGCCCCAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976376 Original CRISPR CCCTCACTTGCCCCAGGAGC AGG Intergenic