ID: 1122976378

View in Genome Browser
Species Human (GRCh38)
Location 14:105172522-105172544
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976368_1122976378 2 Left 1122976368 14:105172497-105172519 CCCAGCCCCAGTCAGGGTGGGGA No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976371_1122976378 -4 Left 1122976371 14:105172503-105172525 CCCAGTCAGGGTGGGGACCCCTC No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976370_1122976378 -3 Left 1122976370 14:105172502-105172524 CCCCAGTCAGGGTGGGGACCCCT No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976372_1122976378 -5 Left 1122976372 14:105172504-105172526 CCAGTCAGGGTGGGGACCCCTCA No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976369_1122976378 1 Left 1122976369 14:105172498-105172520 CCAGCCCCAGTCAGGGTGGGGAC No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976361_1122976378 27 Left 1122976361 14:105172472-105172494 CCGGGCTCCTGTGGAGTGGCTCT No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data
1122976362_1122976378 20 Left 1122976362 14:105172479-105172501 CCTGTGGAGTGGCTCTAGCCCAG No data
Right 1122976378 14:105172522-105172544 CCTCACTTGCCCCAGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976378 Original CRISPR CCTCACTTGCCCCAGGAGCA GGG Intergenic