ID: 1122976700

View in Genome Browser
Species Human (GRCh38)
Location 14:105173840-105173862
Sequence GCCCCCAACCAGATACCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122976696_1122976700 -8 Left 1122976696 14:105173825-105173847 CCACCCCTGTCTGCAGCCCCCAA 0: 1
1: 1
2: 7
3: 51
4: 538
Right 1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1122976692_1122976700 16 Left 1122976692 14:105173801-105173823 CCTGTCAAGGCCAAGCAGAAGAC 0: 1
1: 0
2: 1
3: 9
4: 130
Right 1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1122976693_1122976700 6 Left 1122976693 14:105173811-105173833 CCAAGCAGAAGACCCCACCCCTG 0: 1
1: 0
2: 3
3: 21
4: 291
Right 1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1122976695_1122976700 -7 Left 1122976695 14:105173824-105173846 CCCACCCCTGTCTGCAGCCCCCA 0: 1
1: 0
2: 7
3: 89
4: 652
Right 1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1122976690_1122976700 27 Left 1122976690 14:105173790-105173812 CCTGCCTGCAACCTGTCAAGGCC 0: 1
1: 0
2: 0
3: 20
4: 143
Right 1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1122976694_1122976700 -6 Left 1122976694 14:105173823-105173845 CCCCACCCCTGTCTGCAGCCCCC 0: 1
1: 0
2: 11
3: 161
4: 860
Right 1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 120
1122976691_1122976700 23 Left 1122976691 14:105173794-105173816 CCTGCAACCTGTCAAGGCCAAGC 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122976700 Original CRISPR GCCCCCAACCAGATACCCTG AGG Intronic
900096202 1:941132-941154 TCCCCCACCCAGATCTCCTGAGG + Exonic
902312545 1:15592618-15592640 GCCCCCAGCCAGGCAGCCTGGGG - Intergenic
902333658 1:15742927-15742949 GCCCCCAGCCACATTCCCTGGGG - Intronic
902622661 1:17659484-17659506 GCCCTCATCCAGATTCACTGAGG + Intronic
903184084 1:21619686-21619708 GCCCCCCACCACAAAGCCTGCGG + Intronic
903281080 1:22250385-22250407 GCCCCCTCCCAGACACCCTGTGG + Intergenic
903292619 1:22324355-22324377 GCTCCCACCCAAGTACCCTGTGG - Intergenic
907167001 1:52421623-52421645 ACCCCCCACCAGATACCAAGGGG - Intronic
909043204 1:70678207-70678229 GACCCCAAGTAGATACACTGAGG + Intergenic
915573919 1:156762541-156762563 AGCCCCAACCAGGTACCCAGAGG - Intronic
916674743 1:167055672-167055694 GACCCCCACCAGTTATCCTGTGG + Intronic
916742172 1:167655602-167655624 GCCCTCCACCAGTCACCCTGGGG + Intronic
919731161 1:200914341-200914363 GCCCCCAGCCAGACCCCCTGAGG - Intronic
920847376 1:209605530-209605552 GCTCCCCACCAGAAACACTGTGG - Exonic
921559543 1:216640445-216640467 GCCACCAACCAGCTTCCCTAAGG - Intronic
924385626 1:243496230-243496252 GCCCCCATCCACACATCCTGTGG - Intronic
1062765279 10:57726-57748 GCCCCCCATCACAGACCCTGAGG - Intergenic
1063377679 10:5563846-5563868 GGCCCCAGCCAGATTCCCCGTGG + Intergenic
1070389223 10:75954185-75954207 GCTCTCAACCAGATACGCTGGGG - Intronic
1070593261 10:77815313-77815335 GCAACCAACCAGAGAACCTGAGG - Intronic
1072939694 10:99749943-99749965 GCCCCCAATAACAAACCCTGAGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1088354373 11:108927036-108927058 GCCCTTAAACAGAAACCCTGAGG - Intronic
1091131852 11:133153202-133153224 CCCCGCAGCCAGATACCCAGAGG + Intronic
1097158423 12:57028983-57029005 GCCCCCACCCAGGTTCTCTGGGG - Intronic
1097953117 12:65454999-65455021 TTCCCCAACAAAATACCCTGTGG - Intronic
1101030125 12:100650292-100650314 GCCACAAACCAGGCACCCTGGGG - Intergenic
1110866088 13:80397992-80398014 GCACCCAAACAGAGACCGTGGGG + Intergenic
1111409020 13:87850231-87850253 GACCATATCCAGATACCCTGTGG - Intergenic
1112556847 13:100476836-100476858 CCCCTCAACCAGGTACTCTGGGG - Intronic
1116577131 14:46588477-46588499 GCCACCACCCAGATAACTTGAGG - Intergenic
1120882208 14:89422293-89422315 CTCCCCAACCAGAAACTCTGGGG - Intronic
1122805016 14:104252214-104252236 TCCCCCAAACAGCTGCCCTGGGG + Intergenic
1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG + Intronic
1123033359 14:105461524-105461546 GCCCCCAACCATCAGCCCTGGGG + Intronic
1128323145 15:66706395-66706417 GCCCCCATTCAGCCACCCTGGGG + Intronic
1129604368 15:77017651-77017673 GACCCCAGCCAGACAGCCTGGGG + Intronic
1132513358 16:354554-354576 ACCCCCAACCAGATGCCCACAGG + Intergenic
1137053858 16:35734356-35734378 GCCCCCAAGCGGAGACCATGGGG - Intergenic
1137772744 16:51030136-51030158 GCCCCATACCAATTACCCTGGGG - Intergenic
1141037793 16:80643470-80643492 GCCCCCACACAGAGTCCCTGTGG - Intronic
1141201789 16:81903857-81903879 GCCCCACACCTGATACGCTGTGG + Intronic
1142210997 16:88808429-88808451 GCCCGCAGCCAGAGACCCTCGGG - Exonic
1142439377 16:90085589-90085611 GCCCCCCATCACAGACCCTGAGG + Intronic
1142764154 17:2056403-2056425 GCACCCAGCCAGGTGCCCTGGGG + Intronic
1144094182 17:11884758-11884780 GCCCCCAACCAGAGATACGGAGG - Intronic
1145301916 17:21646744-21646766 CCCCACAACCACATACCTTGGGG - Intergenic
1145328261 17:21849491-21849513 TCCCACAACCACATACCTTGGGG - Intergenic
1148447196 17:47744902-47744924 GCCCCCAGCCAGTAAGCCTGGGG - Exonic
1148853490 17:50566073-50566095 TCCCCCAACCTGATAACCTGTGG + Intronic
1149647348 17:58249898-58249920 GCCGCAGGCCAGATACCCTGGGG + Intronic
1150839515 17:68594893-68594915 GCCCCGTACCAGTTACCCTTGGG - Intronic
1152389332 17:79993371-79993393 TCCCCAAAGCAGATTCCCTGAGG + Intronic
1203192863 17_KI270729v1_random:205676-205698 CCCCACAACCACATACCTTGGGG - Intergenic
1203202227 17_KI270730v1_random:5111-5133 CCCCACAACCACATACCTTGGGG - Intergenic
1152958195 18:58067-58089 GCCCCCCATCACAGACCCTGAGG - Intronic
1153433953 18:5048862-5048884 TGCCCCACCCAGATGCCCTGAGG + Intergenic
1153522480 18:5965794-5965816 CTCCCCAACTAGATGCCCTGAGG - Intronic
1160058826 18:75510896-75510918 GCACTCAACCAGATATGCTGAGG - Intergenic
1160836960 19:1129428-1129450 GCCCCCAAACAGAGACCCCCGGG + Intronic
1162430437 19:10625361-10625383 GCCCCCACCCGGGAACCCTGCGG - Exonic
1164157284 19:22604333-22604355 GCCCCCTCCGAGATCCCCTGGGG - Intergenic
1167459034 19:49614739-49614761 GCCCCCTTCCAGATACACTGTGG - Intronic
925134381 2:1516177-1516199 GCCCCTCACCAGATGCTCTGGGG + Intronic
926121215 2:10242144-10242166 GTCCCCAGCCAGATTCCATGTGG + Intergenic
927853277 2:26513160-26513182 GCCCCCATACTGATTCCCTGAGG + Intronic
930476469 2:51888521-51888543 GCCCCCAACCCCCCACCCTGGGG - Intergenic
931200923 2:60096677-60096699 ACCCCCAAACAGCTTCCCTGGGG + Intergenic
937241042 2:120462934-120462956 GACTCCAGCCAGATCCCCTGGGG - Intergenic
939211107 2:139175856-139175878 GCCCCCATCCAGAAGCTCTGTGG + Intergenic
942338316 2:174915342-174915364 GCCCCCAGCCAGCTTCTCTGTGG + Intronic
943613495 2:190064241-190064263 GACACAAACCAGATGCCCTGAGG + Intronic
946449401 2:219766780-219766802 GCCCACAAGGAGATACCCTGAGG - Intergenic
946614695 2:221497006-221497028 CCCCCCCACCAGAAATCCTGGGG + Intronic
947094828 2:226554253-226554275 GCCCCCAGACAGTTACCATGGGG + Intergenic
948198926 2:236115525-236115547 GCTCCCATCCAGATACCAGGGGG - Intronic
1169641497 20:7757351-7757373 ACCATCAACTAGATACCCTGGGG + Intergenic
1169907710 20:10620094-10620116 GCCACCCACCAGGTACTCTGGGG + Intronic
1170788660 20:19489998-19490020 CCCCCCAACCAGATACACCAAGG - Intronic
1172870183 20:38130945-38130967 GCCCACTCCCAGACACCCTGGGG - Intronic
1174984700 20:55437723-55437745 GCCAACAACCAGACACTCTGCGG - Intergenic
1175261446 20:57676756-57676778 GCACCCACACAGAGACCCTGTGG + Intronic
1176090970 20:63318487-63318509 GTGCCCAGCCAGACACCCTGAGG - Intronic
1176099545 20:63358718-63358740 CCACCCAGCCAGGTACCCTGAGG + Intronic
1176169813 20:63691688-63691710 GACCCCAACCACACACTCTGGGG - Intronic
1176652647 21:9564545-9564567 ACCCACAACCACATACCTTGGGG - Intergenic
1183264864 22:36818919-36818941 GCCCCTAAGCAGCTACCCTGTGG + Intronic
1184713630 22:46268086-46268108 GCCCCCAACCAGGTCCCCCTCGG + Intronic
950456409 3:13095338-13095360 CCTCCCAAGCAGAAACCCTGAGG + Intergenic
952166634 3:30756927-30756949 GCCTCCAACCAGAGTCCATGGGG + Intronic
954368594 3:50158651-50158673 ACCCCCAACCGGATGCACTGCGG - Intronic
959815519 3:110669649-110669671 ACCTCCAACCAGATTCCTTGTGG - Intergenic
959951452 3:112184747-112184769 GCCCCCAGCCGGACCCCCTGAGG + Intronic
961371298 3:126433602-126433624 GCTCCCAACCTGACAGCCTGGGG + Intronic
968044643 3:195617215-195617237 GGCCCCATCCTGATGCCCTGGGG + Intergenic
968060431 3:195723266-195723288 GGCCCCATCCTGATGCCCTGGGG + Intronic
968649269 4:1753981-1754003 GCCCCCAGCCCGACACCATGGGG + Intergenic
968762735 4:2450874-2450896 GCCCCCAAACACATACCAGGTGG - Intronic
969628882 4:8323801-8323823 GCCCCTTCCCAGACACCCTGAGG + Intergenic
979828400 4:125269101-125269123 GTCCCCAACCAAATATCATGTGG + Intergenic
984487400 4:180388570-180388592 CTCCCCAAACAGATGCCCTGTGG + Intergenic
988511347 5:31867275-31867297 GCCCCCAACTGTATACACTGGGG - Intronic
997592679 5:135085606-135085628 CTCCCCAGCCAGAGACCCTGGGG - Intronic
1001485584 5:172117429-172117451 ACCCCCAGGCAGACACCCTGTGG + Intronic
1001540567 5:172534789-172534811 GCCACCCACCAGATGCACTGTGG - Intergenic
1005010096 6:21327937-21327959 GCCCCCAACCCCATACCTGGGGG + Intergenic
1005870627 6:29972108-29972130 GCCCCCAGCCAGATCCAGTGGGG + Intergenic
1016232791 6:141827003-141827025 ATCCACAACCAGATTCCCTGTGG - Intergenic
1016433045 6:144008074-144008096 GCACCCAAACACCTACCCTGCGG + Intronic
1025996044 7:66528192-66528214 GCCCCCCACCAGGTCCCCTCTGG - Intergenic
1027211273 7:76150556-76150578 GCCCCCGACCAGACACCCAGAGG + Intergenic
1027225854 7:76243409-76243431 TCTCCCAACAAGATACCCTGGGG + Intronic
1029646147 7:101857192-101857214 GCCCCCAATCAGATAAGCAGAGG - Intronic
1030977284 7:116142592-116142614 GCCCTCAACAAGTTAACCTGTGG - Intronic
1031737638 7:125386310-125386332 ACCTCCAACCAAATACACTGAGG - Intergenic
1032322571 7:130898193-130898215 GCCCAGAACCACATGCCCTGGGG + Intergenic
1033653407 7:143358750-143358772 CCCTCCAACCTGATCCCCTGTGG - Intronic
1039927626 8:41951496-41951518 GCCCCCAACAAGATTCTCTAGGG - Intronic
1043392303 8:79803616-79803638 GCTCCAAACAAAATACCCTGAGG + Intergenic
1052858267 9:33420583-33420605 CCACCCCACCAGAAACCCTGGGG - Intergenic
1053017458 9:34670840-34670862 GCCACCCACTAGATTCCCTGAGG + Intergenic
1061111671 9:128576755-128576777 TCCTCCAACTAGTTACCCTGGGG - Intronic
1061655590 9:132087482-132087504 GCCCCTAACAACATACCCAGTGG - Intergenic
1062739968 9:138166533-138166555 GCCCCCCATCACAAACCCTGAGG + Intergenic
1203630377 Un_KI270750v1:68086-68108 ACCCACAACCACATACCTTGGGG - Intergenic
1186220529 X:7344715-7344737 GCCCCCAACCTGGAACTCTGAGG - Intronic
1192183265 X:68929519-68929541 TCCCCCACCCAGGTGCCCTGAGG + Intergenic
1198806831 X:140502136-140502158 GGCCCCAAACAGATACACTGGGG + Intergenic
1200034962 X:153321085-153321107 TCCCCCACCCAGAATCCCTGCGG + Intergenic
1201760439 Y:17530980-17531002 GCCCCCCATCACAGACCCTGGGG - Intergenic
1201841115 Y:18375010-18375032 GCCCCCCATCACAGACCCTGGGG + Intergenic
1201867346 Y:18669441-18669463 GACCCCAACAAGATCCACTGGGG - Intergenic