ID: 1122977934

View in Genome Browser
Species Human (GRCh38)
Location 14:105178603-105178625
Sequence TGCCGGAGATGGGACCCCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122977934_1122977942 9 Left 1122977934 14:105178603-105178625 CCCGCGGGGTCCCATCTCCGGCA 0: 1
1: 0
2: 2
3: 5
4: 98
Right 1122977942 14:105178635-105178657 CATCTGCCACTCTGAGGCCCAGG 0: 1
1: 0
2: 2
3: 28
4: 312
1122977934_1122977939 3 Left 1122977934 14:105178603-105178625 CCCGCGGGGTCCCATCTCCGGCA 0: 1
1: 0
2: 2
3: 5
4: 98
Right 1122977939 14:105178629-105178651 TCAGCCCATCTGCCACTCTGAGG 0: 1
1: 0
2: 5
3: 19
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122977934 Original CRISPR TGCCGGAGATGGGACCCCGC GGG (reversed) Intronic
900536498 1:3180455-3180477 TGCCCAAGATGGGACCCACCGGG - Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
903966862 1:27096112-27096134 TACCAGGGATGGGACCCAGCAGG - Intergenic
904068415 1:27773347-27773369 TCCCGGAGCTGGGGCCCCGAGGG - Exonic
904908773 1:33918272-33918294 TGCCTGTGGTGGGACCCTGCGGG - Exonic
905453136 1:38069933-38069955 TGGCAGAGCTGGGACCCAGCTGG + Intergenic
906490885 1:46267521-46267543 TTCCGGAGATGAGCACCCGCCGG - Exonic
1070461827 10:76678000-76678022 TGTCAGAGATGGGAACCTGCTGG + Intergenic
1071671673 10:87614801-87614823 TGCTGGAGGTGGGGCCCCGTGGG - Intergenic
1076138704 10:128063013-128063035 TGCCGGGGCTGGGACCCCAAAGG + Intronic
1077361964 11:2144782-2144804 TGCCAGAGAGGGGGCACCGCTGG + Intronic
1084037863 11:66523879-66523901 TGCCGGAGATGGGGCTCACCGGG - Exonic
1094093728 12:26679450-26679472 AGCAGGAAATGGGACCCTGCAGG + Intronic
1100617821 12:96244967-96244989 TGGCGTAAATGAGACCCCGCGGG + Intronic
1108228868 13:48317787-48317809 TGCCGGCTGTGGGACCCCCCTGG + Intronic
1112377825 13:98860408-98860430 TGCCGGAGATGGCGCCCAGCAGG + Exonic
1113601608 13:111573361-111573383 TGCCGCAGATGAGCCCCAGCCGG + Intergenic
1122627448 14:103091630-103091652 TACCGGGGACGGGACCTCGCTGG - Intergenic
1122691456 14:103533773-103533795 TGCCGGCCACGGGAGCCCGCTGG + Intronic
1122850190 14:104523849-104523871 TGCTGGAGGTGGGACCCGGTGGG - Intronic
1122859966 14:104578108-104578130 GGCCGGAAATATGACCCCGCTGG + Intronic
1122977934 14:105178603-105178625 TGCCGGAGATGGGACCCCGCGGG - Intronic
1123434733 15:20246890-20246912 TGCTTGAGATGGGAGCCCACTGG + Intergenic
1124789879 15:32717826-32717848 GGGCGGAGAGGGGACCCCGCGGG + Intergenic
1125687505 15:41572347-41572369 AGCTAGAGATGGGACCCAGCAGG + Intronic
1128637663 15:69313660-69313682 TGCCGGAAATGGGGCCTCCCTGG - Intronic
1128787998 15:70412468-70412490 TGCCTGAGATGGCACCCGGCAGG + Intergenic
1130969564 15:88721374-88721396 TGTAGGTGATGGGACCCTGCTGG - Intergenic
1132499645 16:279823-279845 TGGGGGGGATGGGACCCGGCAGG - Intronic
1132987922 16:2777512-2777534 TGCCCGAGCTTGGAGCCCGCCGG - Intergenic
1133193577 16:4152384-4152406 TGCTGAAGAAGGGACCCTGCGGG + Intergenic
1136220091 16:28823189-28823211 GGCCGGGGCTGGGGCCCCGCTGG - Exonic
1136849893 16:33604220-33604242 TGCGTGAGATGGGAGCCCACTGG - Intergenic
1137565641 16:49531019-49531041 TGCTGGCGAGGGGACCCCCCAGG - Intronic
1138607324 16:58097440-58097462 GGCTGGAGATGGGGCCCAGCTGG + Intergenic
1138935728 16:61719778-61719800 TGTGGGAGATGGGACCCAGTTGG - Intronic
1138978879 16:62242211-62242233 TGCTGGAGATGGGACCTGGTGGG + Intergenic
1142232072 16:88904691-88904713 TGCAGGAGATGGGACCTTTCCGG + Intronic
1142232091 16:88904744-88904766 TGCAGGTGATGGGACCTCACGGG + Intronic
1203111504 16_KI270728v1_random:1452673-1452695 TGCGTGAGATGGGAGCCCACTGG - Intergenic
1150877367 17:68984999-68985021 TGCCGTAGATGGGAACCAGAGGG - Intronic
1151205563 17:72504067-72504089 TGCTGGACATGGGACCCAGGTGG + Intergenic
1151434854 17:74088821-74088843 AGCCGGAGATGTGCCCCAGCTGG + Intergenic
1152734750 17:81991921-81991943 TGCCGGAGCGGGGCCCCAGCGGG + Intronic
1157600967 18:48893152-48893174 TGTCGGGGATGGGACCCTCCTGG - Intergenic
1160730730 19:640623-640645 TGGCGGAGCTGGGTCCCCACAGG + Intronic
1160954905 19:1686664-1686686 TGCCGGTGGTGGGACCTCACAGG - Intergenic
1161297171 19:3526009-3526031 GGCAGGAGATGGGACCCCCCGGG + Intronic
1163020642 19:14479380-14479402 TGCCGGAGATAGGGTCCGGCTGG + Intronic
1165096249 19:33411425-33411447 TGCAGGAGAGGGGCCCCCGATGG - Intronic
1165523357 19:36331629-36331651 TGCCGGACATGGGACGCTGGAGG - Intergenic
1167134334 19:47608370-47608392 CCCCGGAGGTGGGACCGCGCCGG - Intronic
927572505 2:24172056-24172078 TGCCAGAGATGGGACCACGCAGG + Intronic
931582063 2:63787229-63787251 TGCTGGAGATGGGCCCCTGTGGG + Intronic
932773271 2:74513407-74513429 TCCCGGGGATGGGACCCCCGCGG - Intergenic
933319620 2:80757450-80757472 AGCTGTAGATGGGACCCTGCCGG - Intergenic
936093588 2:109515923-109515945 TGCTGGAGATGGGGCCTGGCAGG - Intergenic
938311167 2:130288848-130288870 CTCCGGAGCTGCGACCCCGCAGG - Intergenic
943639669 2:190344123-190344145 TGCCGGGGCAGGGACCTCGCAGG - Intronic
949036660 2:241818638-241818660 TGCCTGAGAGGGGACACCACTGG + Intergenic
1169872477 20:10262766-10262788 TGCCAAAGTTGGGACCCTGCTGG - Intronic
1169948691 20:11017656-11017678 TGTCAGAGATGGGCCCCAGCTGG - Intergenic
1173427580 20:42956246-42956268 TGCCGGAGGTGGGACCTAGTGGG + Intronic
1173753890 20:45498056-45498078 TGCAAGAGATGGGACCCCTGGGG + Intergenic
1179583698 21:42361476-42361498 TACTGGAGATGGGATCCCCCGGG - Intergenic
1179978936 21:44886554-44886576 TGCCGGTGCTGGGACCCTGGGGG - Intronic
1180110697 21:45647669-45647691 TGAAGGAGTTGGGACCCTGCTGG + Intronic
1184257375 22:43294904-43294926 TGCCTGAGCTGGGGCCTCGCTGG - Intronic
957526774 3:81388212-81388234 TGGTGGAGGTGGGACCCTGCAGG - Intergenic
957720806 3:83995840-83995862 TGCCGGAGGTGGGACCTAGTGGG - Intergenic
960902161 3:122564198-122564220 TGCAGGAGAGGGGACCCCGAGGG + Intronic
967919587 3:194604379-194604401 CGCCGGAGATGCGTCCCTGCAGG - Exonic
972562831 4:40243745-40243767 AGCGGGAGATGGGGCCCCACAGG + Exonic
972630467 4:40837372-40837394 TGTCTGAGATGGGACCCTCCTGG - Intronic
976246547 4:83011022-83011044 TGCCGGACTTGGGACCCCGCAGG - Intronic
976431155 4:84965758-84965780 TCCGGGAGCTGAGACCCCGCAGG + Intronic
976595658 4:86892516-86892538 TACCAGAGAGCGGACCCCGCGGG - Intronic
978540640 4:109813203-109813225 TGTCGTAGATGGGACCTCGTGGG - Intergenic
985781341 5:1873515-1873537 TTCTGGAGGTGGGATCCCGCAGG - Intergenic
990818036 5:59807356-59807378 TGGGGGAAATGGGACCCCACAGG - Intronic
995849738 5:116532563-116532585 TGCAGGAGATGGAGCCCCTCTGG + Intronic
997576033 5:134978046-134978068 TGTTGGAGATGGGGCCCAGCAGG - Intronic
997817967 5:137036174-137036196 TGCCAGAGCTGGTACCCAGCAGG - Intronic
998161138 5:139813600-139813622 TGCTGGAGATGGAGCGCCGCAGG - Exonic
1001600387 5:172924469-172924491 TGCCTGAAATGGGAGCCGGCAGG + Intronic
1006037935 6:31228722-31228744 TGCAGGAGATGGGAGCATGCGGG + Intergenic
1007251502 6:40498204-40498226 AGCAGGAGATGGGACACAGCTGG + Intronic
1007784294 6:44271054-44271076 TGCCGGGGAAGGGGCCGCGCCGG + Intronic
1017812856 6:157996627-157996649 TGCTGGAGATGGGGCCCAGTGGG + Intronic
1018608363 6:165622837-165622859 TGCTGGAGGTGGGGCCCCGTGGG + Intronic
1019403845 7:872169-872191 TGGCAGAGAAGTGACCCCGCCGG - Intronic
1019657111 7:2201783-2201805 TGTGGGTGTTGGGACCCCGCAGG - Intronic
1021101160 7:16586806-16586828 GGCCGGGGCTGGGGCCCCGCGGG + Intergenic
1029131618 7:98335737-98335759 TGCCGGAGAGGAGTCCCAGCGGG - Intronic
1033153201 7:138934576-138934598 TGCCGGAGATGAGAGCTTGCAGG + Intronic
1033784951 7:144718700-144718722 TGCTGGAGATGGGACCTGGTGGG + Intronic
1036207601 8:6816415-6816437 AGCCGGAGACGGGAGCTCGCAGG + Intronic
1041549191 8:59080607-59080629 TGCTGGAGGTGGGACCTGGCGGG + Intronic
1044971988 8:97628757-97628779 TGCAGGAGATGGCCACCCGCAGG + Intergenic
1046670948 8:117055484-117055506 AGCTGGAGAAGGGCCCCCGCTGG - Intronic
1049235226 8:141508796-141508818 AGCTGGAGGTGGGACCCAGCTGG - Intergenic
1051183678 9:14437706-14437728 TGCTGGAGATAGGACTCAGCTGG - Intergenic
1061556528 9:131373403-131373425 TGCCGGCGCCGGGACCCTGCGGG + Intergenic
1186508048 X:10109925-10109947 TGCGGGAGATGTGGCCCGGCTGG + Exonic
1194235862 X:91382400-91382422 TGCTGGAGATGGGGCCCAGTGGG + Intergenic
1199737068 X:150694149-150694171 ACGGGGAGATGGGACCCCGCGGG + Intronic