ID: 1122978133

View in Genome Browser
Species Human (GRCh38)
Location 14:105179370-105179392
Sequence GCGTCCAGCCCAATGTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122978129_1122978133 -6 Left 1122978129 14:105179353-105179375 CCCCTGGGTGGCAGCCAGCGTCC 0: 1
1: 0
2: 4
3: 12
4: 194
Right 1122978133 14:105179370-105179392 GCGTCCAGCCCAATGTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1122978130_1122978133 -7 Left 1122978130 14:105179354-105179376 CCCTGGGTGGCAGCCAGCGTCCA 0: 1
1: 0
2: 0
3: 23
4: 194
Right 1122978133 14:105179370-105179392 GCGTCCAGCCCAATGTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 75
1122978131_1122978133 -8 Left 1122978131 14:105179355-105179377 CCTGGGTGGCAGCCAGCGTCCAG 0: 1
1: 0
2: 1
3: 22
4: 248
Right 1122978133 14:105179370-105179392 GCGTCCAGCCCAATGTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122978133 Original CRISPR GCGTCCAGCCCAATGTCCCT TGG Intronic
902621043 1:17651346-17651368 GCCTCCAGCCCAAGGCCCCAGGG - Intronic
904405025 1:30282749-30282771 TTGTCCAACCCACTGTCCCTGGG + Intergenic
916077000 1:161206903-161206925 GCGTCAAAGCCAGTGTCCCTAGG + Intronic
1063975289 10:11410345-11410367 GAGGCCAACCCATTGTCCCTGGG + Intergenic
1070624399 10:78039838-78039860 GTGTCCAGCACAATGTTGCTGGG + Intronic
1073513117 10:104054810-104054832 GTGTCCAGCCAAAGGTCCCTGGG + Intronic
1074719361 10:116251195-116251217 CTGTCCATGCCAATGTCCCTAGG + Intronic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1077358054 11:2127705-2127727 GCCTCCAGCCCCATGAGCCTGGG - Intergenic
1081638150 11:44734622-44734644 GAGTCCAGCCCAAGGTTGCTGGG - Intronic
1085339104 11:75719785-75719807 ACGGCCAGCCCAGTGTCACTGGG - Intronic
1087242111 11:95790931-95790953 GCGGCCAGCCCAGTTTCACTGGG - Intronic
1091095675 11:132819935-132819957 GCCTCCAGCCCCAGGACCCTGGG - Intronic
1091295805 11:134473246-134473268 GCTTCTGGCCCAATGTCCCTAGG - Intergenic
1091825877 12:3512307-3512329 GCCTCCAGCCTACTGTCCCTGGG + Intronic
1091855548 12:3736454-3736476 GCCTCCACTCCAATGTCCCATGG - Intronic
1096571190 12:52524220-52524242 TCCTACAGCCCAATGTCTCTAGG + Intergenic
1101242603 12:102853045-102853067 GCGTCAAAGCCTATGTCCCTGGG - Intronic
1113415175 13:110123433-110123455 GGCTCCAGCCCGAGGTCCCTGGG - Intergenic
1118324611 14:64772650-64772672 GCGTCCAGCCCCACGTCCTCGGG + Exonic
1119620094 14:76125447-76125469 ACGTCCACTCCAATGTCCCTGGG - Intergenic
1122978133 14:105179370-105179392 GCGTCCAGCCCAATGTCCCTTGG + Intronic
1123000334 14:105290507-105290529 GCCTGCAGCCCACTGTACCTAGG - Intronic
1125889119 15:43252639-43252661 GCTTCCTTCCAAATGTCCCTTGG + Intronic
1128787940 15:70412162-70412184 GCGTCCGTGCCTATGTCCCTGGG - Intergenic
1129597549 15:76976378-76976400 GCCTCCAGCCCCAAGTCCCTAGG + Intergenic
1131131517 15:89903594-89903616 CTGTCGAGCCCAATGGCCCTAGG + Intronic
1136588185 16:31201395-31201417 GCCTCCAGCTCCATGTCCCTAGG - Intergenic
1141941408 16:87278460-87278482 GCCTCTTGCCCAATGCCCCTAGG - Intronic
1142850938 17:2704468-2704490 TCGTCAAGCCCATTTTCCCTGGG + Exonic
1142851203 17:2705649-2705671 GGGTGCAGCCGAATGTCTCTGGG - Intronic
1146352965 17:32111430-32111452 GCTTCGAGACCAAGGTCCCTGGG + Intergenic
1150296457 17:64011047-64011069 CAGACCAGCCCAATGTCTCTTGG + Intronic
1152334411 17:79692279-79692301 CCGTCCAGGCCGCTGTCCCTGGG + Intergenic
1152848246 17:82615793-82615815 GCTTCGAGACCAAGGTCCCTGGG + Exonic
1155680507 18:28480998-28481020 GCTTCCTGCCCCGTGTCCCTCGG + Intergenic
1157168644 18:45381928-45381950 CAGCCCAGCCCATTGTCCCTGGG - Intronic
1157514913 18:48304036-48304058 GCGACCAGCCCAGGGTCCCCTGG + Intronic
1161630409 19:5352126-5352148 TCTTCCAGCCCATTGCCCCTGGG + Intergenic
1163671978 19:18634785-18634807 GCAGCCAGTGCAATGTCCCTGGG - Intergenic
1164950733 19:32334618-32334640 AGGTCCAGCCTGATGTCCCTGGG - Intergenic
1165161741 19:33820543-33820565 GCGTCCAGCCCGGGGCCCCTGGG - Intergenic
1166099873 19:40565594-40565616 GCTTCCACCCCAATGTGCCCGGG - Intronic
928201824 2:29252105-29252127 GTGTCCCACCCAACGTCCCTAGG + Intronic
928336311 2:30401396-30401418 GGATCCAGCCCCATTTCCCTCGG + Intergenic
931443414 2:62307243-62307265 GTGTCCAGCCCCCTGTCCCCTGG + Intergenic
938066363 2:128283997-128284019 CCGTCCAGGCCTGTGTCCCTCGG - Intronic
939997085 2:148930088-148930110 GAGTCCAGCCCCATGTACGTGGG - Intronic
947817655 2:233048804-233048826 GCCTCCATCCCATTGTCCCCAGG - Intergenic
1175599564 20:60262139-60262161 TAGTCCTGCCCCATGTCCCTGGG - Intergenic
1183680749 22:39327909-39327931 GAGTGCAGCCTCATGTCCCTGGG + Intergenic
1184421677 22:44385908-44385930 GCTCCCAGGCCAGTGTCCCTCGG + Intergenic
1184580584 22:45413917-45413939 GCGTCCTGCCGCAAGTCCCTGGG - Exonic
953908853 3:46882103-46882125 GCCTCTAGCGCAATGTCCCGGGG + Intronic
961431531 3:126887569-126887591 GCGAGTAGCCCAGTGTCCCTGGG + Intronic
969633757 4:8353403-8353425 GTGTCCAGGGCAATGTCCCCCGG + Intergenic
971703299 4:30007946-30007968 GCATCCACCCCAATGTCTCAGGG - Intergenic
979878738 4:125928129-125928151 CCCTCCAGTCCACTGTCCCTGGG - Intergenic
980072152 4:128254723-128254745 CTTTCCAGCCAAATGTCCCTAGG - Intergenic
982565933 4:156986620-156986642 CACTCCAGCCCCATGTCCCTTGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
993101492 5:83546113-83546135 GCAACCAGCCCAACGTGCCTCGG + Intronic
998095800 5:139394933-139394955 GCGTCCGGCCCAACGTCCGGGGG + Exonic
999826095 5:155275081-155275103 GCTTCCAGCCAAAGGACCCTGGG - Intergenic
1002926981 6:1610464-1610486 GTGTCCAGCCCCAACTCCCTGGG + Exonic
1008071580 6:47103838-47103860 GCGTCCATCCCCCTGTCCTTAGG - Intergenic
1010158135 6:72819670-72819692 GCTTCCAGTCCAGTGTCCCAGGG + Intronic
1011663856 6:89616791-89616813 AAGTCCACCCCAATGGCCCTGGG - Intronic
1019443472 7:1059301-1059323 GCCTCCAGCCCTCTGTCCCCTGG - Intronic
1020617456 7:10476982-10477004 GCTTCCAGTCCTGTGTCCCTTGG + Intergenic
1024895579 7:54257748-54257770 GCATCCAGCTTAATGTCCATTGG - Intergenic
1028988769 7:97027613-97027635 GCGTCCAGCCCGCTGGCCTTAGG - Intergenic
1035758538 8:2052219-2052241 GCCTCCAGCCAGACGTCCCTGGG + Exonic
1039846475 8:41329429-41329451 GCTTAAAACCCAATGTCCCTGGG + Intergenic
1049424903 8:142533638-142533660 GTGTCCACCCCACTCTCCCTGGG + Intronic
1059882044 9:118702010-118702032 GAGAGCAGCCCAATGTCCCTGGG - Intergenic
1060450764 9:123736835-123736857 ACGTCTTGCCCAATGTCACTGGG + Intronic
1060989301 9:127839032-127839054 ACGTCCAGCCCCATGCCGCTAGG + Intronic
1061963534 9:134000139-134000161 GCTTAGAGCCCAGTGTCCCTTGG - Intergenic
1062239480 9:135527961-135527983 GCGTCCTCCCCACTGTGCCTCGG + Intergenic
1062481661 9:136755216-136755238 GCCTCCACCCCAAGGCCCCTGGG + Intronic
1196660452 X:118263867-118263889 GCCTCCAGTCCACTGTCTCTGGG - Intergenic
1198263822 X:134991052-134991074 GCGTCCATCCCTCTGTCCCACGG + Exonic