ID: 1122979291

View in Genome Browser
Species Human (GRCh38)
Location 14:105184476-105184498
Sequence TTCTCCTGCCTTGGATCTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122979291_1122979297 -1 Left 1122979291 14:105184476-105184498 CCCGAAGATCCAAGGCAGGAGAA No data
Right 1122979297 14:105184498-105184520 AAGGAAGCTGTCCTGGCAGGAGG No data
1122979291_1122979298 8 Left 1122979291 14:105184476-105184498 CCCGAAGATCCAAGGCAGGAGAA No data
Right 1122979298 14:105184507-105184529 GTCCTGGCAGGAGGAGACCGAGG No data
1122979291_1122979296 -4 Left 1122979291 14:105184476-105184498 CCCGAAGATCCAAGGCAGGAGAA No data
Right 1122979296 14:105184495-105184517 AGAAAGGAAGCTGTCCTGGCAGG No data
1122979291_1122979295 -8 Left 1122979291 14:105184476-105184498 CCCGAAGATCCAAGGCAGGAGAA No data
Right 1122979295 14:105184491-105184513 CAGGAGAAAGGAAGCTGTCCTGG No data
1122979291_1122979300 18 Left 1122979291 14:105184476-105184498 CCCGAAGATCCAAGGCAGGAGAA No data
Right 1122979300 14:105184517-105184539 GAGGAGACCGAGGCCAGAAGAGG No data
1122979291_1122979302 26 Left 1122979291 14:105184476-105184498 CCCGAAGATCCAAGGCAGGAGAA No data
Right 1122979302 14:105184525-105184547 CGAGGCCAGAAGAGGCGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122979291 Original CRISPR TTCTCCTGCCTTGGATCTTC GGG (reversed) Intergenic
No off target data available for this crispr