ID: 1122979496

View in Genome Browser
Species Human (GRCh38)
Location 14:105185260-105185282
Sequence CAGAAGAGGGAGCAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122979496_1122979509 20 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979509 14:105185303-105185325 TAGGGCCCCCCCGGGTCATCCGG No data
1122979496_1122979518 30 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979518 14:105185313-105185335 CCGGGTCATCCGGGGCCATCCGG No data
1122979496_1122979511 22 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979511 14:105185305-105185327 GGGCCCCCCCGGGTCATCCGGGG No data
1122979496_1122979508 12 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979508 14:105185295-105185317 CCACAATTTAGGGCCCCCCCGGG No data
1122979496_1122979510 21 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979510 14:105185304-105185326 AGGGCCCCCCCGGGTCATCCGGG No data
1122979496_1122979503 1 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979503 14:105185284-105185306 GGTCCTTGTGACCACAATTTAGG No data
1122979496_1122979504 2 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979504 14:105185285-105185307 GTCCTTGTGACCACAATTTAGGG No data
1122979496_1122979506 11 Left 1122979496 14:105185260-105185282 CCACCCTCCTGCTCCCTCTTCTG No data
Right 1122979506 14:105185294-105185316 ACCACAATTTAGGGCCCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122979496 Original CRISPR CAGAAGAGGGAGCAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr