ID: 1122981534

View in Genome Browser
Species Human (GRCh38)
Location 14:105194359-105194381
Sequence CTTGGGGGATGGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122981534_1122981547 15 Left 1122981534 14:105194359-105194381 CCCTCTTCCTTCCATCCCCCAAG No data
Right 1122981547 14:105194397-105194419 CTCTAGCACACAGAGACTGTGGG No data
1122981534_1122981546 14 Left 1122981534 14:105194359-105194381 CCCTCTTCCTTCCATCCCCCAAG No data
Right 1122981546 14:105194396-105194418 TCTCTAGCACACAGAGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122981534 Original CRISPR CTTGGGGGATGGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr