ID: 1122981822

View in Genome Browser
Species Human (GRCh38)
Location 14:105195476-105195498
Sequence AAGGAAGTCCAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122981816_1122981822 -6 Left 1122981816 14:105195459-105195481 CCCTGGAAGCTCTGTCCAAGGAA No data
Right 1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG No data
1122981811_1122981822 23 Left 1122981811 14:105195430-105195452 CCGCATCTCCCACACTCTCTTGC No data
Right 1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG No data
1122981813_1122981822 14 Left 1122981813 14:105195439-105195461 CCACACTCTCTTGCTGACTTCCC No data
Right 1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG No data
1122981812_1122981822 15 Left 1122981812 14:105195438-105195460 CCCACACTCTCTTGCTGACTTCC No data
Right 1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG No data
1122981817_1122981822 -7 Left 1122981817 14:105195460-105195482 CCTGGAAGCTCTGTCCAAGGAAG No data
Right 1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG No data
1122981810_1122981822 26 Left 1122981810 14:105195427-105195449 CCTCCGCATCTCCCACACTCTCT No data
Right 1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122981822 Original CRISPR AAGGAAGTCCAGAAGGAGGA GGG Intergenic
No off target data available for this crispr